зеркало из https://github.com/mozilla/gecko-dev.git
Bug 549503: more SunSpider verification tests, r=dvander
--HG-- extra : rebase_source : 15ebc76e6de2c982ca77bb6a271f691ddc8559a8
This commit is contained in:
Родитель
ffafb514ed
Коммит
8befd2ecbb
|
@ -0,0 +1,345 @@
|
|||
// 3D Cube Rotation
|
||||
// http://www.speich.net/computer/moztesting/3d.htm
|
||||
// Created by Simon Speich
|
||||
|
||||
var Q = new Array();
|
||||
var MTrans = new Array(); // transformation matrix
|
||||
var MQube = new Array(); // position information of qube
|
||||
var I = new Array(); // entity matrix
|
||||
var Origin = new Object();
|
||||
var Testing = new Object();
|
||||
var LoopTimer;
|
||||
|
||||
var DisplArea = new Object();
|
||||
DisplArea.Width = 300;
|
||||
DisplArea.Height = 300;
|
||||
|
||||
function DrawLine(From, To) {
|
||||
var x1 = From.V[0];
|
||||
var x2 = To.V[0];
|
||||
var y1 = From.V[1];
|
||||
var y2 = To.V[1];
|
||||
var dx = Math.abs(x2 - x1);
|
||||
var dy = Math.abs(y2 - y1);
|
||||
var x = x1;
|
||||
var y = y1;
|
||||
var IncX1, IncY1;
|
||||
var IncX2, IncY2;
|
||||
var Den;
|
||||
var Num;
|
||||
var NumAdd;
|
||||
var NumPix;
|
||||
|
||||
if (x2 >= x1) { IncX1 = 1; IncX2 = 1; }
|
||||
else { IncX1 = -1; IncX2 = -1; }
|
||||
if (y2 >= y1) { IncY1 = 1; IncY2 = 1; }
|
||||
else { IncY1 = -1; IncY2 = -1; }
|
||||
if (dx >= dy) {
|
||||
IncX1 = 0;
|
||||
IncY2 = 0;
|
||||
Den = dx;
|
||||
Num = dx / 2;
|
||||
NumAdd = dy;
|
||||
NumPix = dx;
|
||||
}
|
||||
else {
|
||||
IncX2 = 0;
|
||||
IncY1 = 0;
|
||||
Den = dy;
|
||||
Num = dy / 2;
|
||||
NumAdd = dx;
|
||||
NumPix = dy;
|
||||
}
|
||||
|
||||
NumPix = Math.round(Q.LastPx + NumPix);
|
||||
|
||||
var i = Q.LastPx;
|
||||
for (; i < NumPix; i++) {
|
||||
Num += NumAdd;
|
||||
if (Num >= Den) {
|
||||
Num -= Den;
|
||||
x += IncX1;
|
||||
y += IncY1;
|
||||
}
|
||||
x += IncX2;
|
||||
y += IncY2;
|
||||
}
|
||||
Q.LastPx = NumPix;
|
||||
}
|
||||
|
||||
function CalcCross(V0, V1) {
|
||||
var Cross = new Array();
|
||||
Cross[0] = V0[1]*V1[2] - V0[2]*V1[1];
|
||||
Cross[1] = V0[2]*V1[0] - V0[0]*V1[2];
|
||||
Cross[2] = V0[0]*V1[1] - V0[1]*V1[0];
|
||||
return Cross;
|
||||
}
|
||||
|
||||
function CalcNormal(V0, V1, V2) {
|
||||
var A = new Array(); var B = new Array();
|
||||
for (var i = 0; i < 3; i++) {
|
||||
A[i] = V0[i] - V1[i];
|
||||
B[i] = V2[i] - V1[i];
|
||||
}
|
||||
A = CalcCross(A, B);
|
||||
var Length = Math.sqrt(A[0]*A[0] + A[1]*A[1] + A[2]*A[2]);
|
||||
for (var i = 0; i < 3; i++) A[i] = A[i] / Length;
|
||||
A[3] = 1;
|
||||
return A;
|
||||
}
|
||||
|
||||
function CreateP(X,Y,Z) {
|
||||
this.V = [X,Y,Z,1];
|
||||
}
|
||||
|
||||
// multiplies two matrices
|
||||
function MMulti(M1, M2) {
|
||||
var M = [[],[],[],[]];
|
||||
var i = 0;
|
||||
var j = 0;
|
||||
for (; i < 4; i++) {
|
||||
j = 0;
|
||||
for (; j < 4; j++) M[i][j] = M1[i][0] * M2[0][j] + M1[i][1] * M2[1][j] + M1[i][2] * M2[2][j] + M1[i][3] * M2[3][j];
|
||||
}
|
||||
return M;
|
||||
}
|
||||
|
||||
//multiplies matrix with vector
|
||||
function VMulti(M, V) {
|
||||
var Vect = new Array();
|
||||
var i = 0;
|
||||
for (;i < 4; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2] + M[i][3] * V[3];
|
||||
return Vect;
|
||||
}
|
||||
|
||||
function VMulti2(M, V) {
|
||||
var Vect = new Array();
|
||||
var i = 0;
|
||||
for (;i < 3; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2];
|
||||
return Vect;
|
||||
}
|
||||
|
||||
// add to matrices
|
||||
function MAdd(M1, M2) {
|
||||
var M = [[],[],[],[]];
|
||||
var i = 0;
|
||||
var j = 0;
|
||||
for (; i < 4; i++) {
|
||||
j = 0;
|
||||
for (; j < 4; j++) M[i][j] = M1[i][j] + M2[i][j];
|
||||
}
|
||||
return M;
|
||||
}
|
||||
|
||||
function Translate(M, Dx, Dy, Dz) {
|
||||
var T = [
|
||||
[1,0,0,Dx],
|
||||
[0,1,0,Dy],
|
||||
[0,0,1,Dz],
|
||||
[0,0,0,1]
|
||||
];
|
||||
return MMulti(T, M);
|
||||
}
|
||||
|
||||
function RotateX(M, Phi) {
|
||||
var a = Phi;
|
||||
a *= Math.PI / 180;
|
||||
var Cos = Math.cos(a);
|
||||
var Sin = Math.sin(a);
|
||||
var R = [
|
||||
[1,0,0,0],
|
||||
[0,Cos,-Sin,0],
|
||||
[0,Sin,Cos,0],
|
||||
[0,0,0,1]
|
||||
];
|
||||
return MMulti(R, M);
|
||||
}
|
||||
|
||||
function RotateY(M, Phi) {
|
||||
var a = Phi;
|
||||
a *= Math.PI / 180;
|
||||
var Cos = Math.cos(a);
|
||||
var Sin = Math.sin(a);
|
||||
var R = [
|
||||
[Cos,0,Sin,0],
|
||||
[0,1,0,0],
|
||||
[-Sin,0,Cos,0],
|
||||
[0,0,0,1]
|
||||
];
|
||||
return MMulti(R, M);
|
||||
}
|
||||
|
||||
function RotateZ(M, Phi) {
|
||||
var a = Phi;
|
||||
a *= Math.PI / 180;
|
||||
var Cos = Math.cos(a);
|
||||
var Sin = Math.sin(a);
|
||||
var R = [
|
||||
[Cos,-Sin,0,0],
|
||||
[Sin,Cos,0,0],
|
||||
[0,0,1,0],
|
||||
[0,0,0,1]
|
||||
];
|
||||
return MMulti(R, M);
|
||||
}
|
||||
|
||||
function DrawQube() {
|
||||
// calc current normals
|
||||
var CurN = new Array();
|
||||
var i = 5;
|
||||
Q.LastPx = 0;
|
||||
for (; i > -1; i--) CurN[i] = VMulti2(MQube, Q.Normal[i]);
|
||||
if (CurN[0][2] < 0) {
|
||||
if (!Q.Line[0]) { DrawLine(Q[0], Q[1]); Q.Line[0] = true; };
|
||||
if (!Q.Line[1]) { DrawLine(Q[1], Q[2]); Q.Line[1] = true; };
|
||||
if (!Q.Line[2]) { DrawLine(Q[2], Q[3]); Q.Line[2] = true; };
|
||||
if (!Q.Line[3]) { DrawLine(Q[3], Q[0]); Q.Line[3] = true; };
|
||||
}
|
||||
if (CurN[1][2] < 0) {
|
||||
if (!Q.Line[2]) { DrawLine(Q[3], Q[2]); Q.Line[2] = true; };
|
||||
if (!Q.Line[9]) { DrawLine(Q[2], Q[6]); Q.Line[9] = true; };
|
||||
if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
|
||||
if (!Q.Line[10]) { DrawLine(Q[7], Q[3]); Q.Line[10] = true; };
|
||||
}
|
||||
if (CurN[2][2] < 0) {
|
||||
if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
|
||||
if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
|
||||
if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
|
||||
if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
|
||||
}
|
||||
if (CurN[3][2] < 0) {
|
||||
if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
|
||||
if (!Q.Line[8]) { DrawLine(Q[5], Q[1]); Q.Line[8] = true; };
|
||||
if (!Q.Line[0]) { DrawLine(Q[1], Q[0]); Q.Line[0] = true; };
|
||||
if (!Q.Line[11]) { DrawLine(Q[0], Q[4]); Q.Line[11] = true; };
|
||||
}
|
||||
if (CurN[4][2] < 0) {
|
||||
if (!Q.Line[11]) { DrawLine(Q[4], Q[0]); Q.Line[11] = true; };
|
||||
if (!Q.Line[3]) { DrawLine(Q[0], Q[3]); Q.Line[3] = true; };
|
||||
if (!Q.Line[10]) { DrawLine(Q[3], Q[7]); Q.Line[10] = true; };
|
||||
if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
|
||||
}
|
||||
if (CurN[5][2] < 0) {
|
||||
if (!Q.Line[8]) { DrawLine(Q[1], Q[5]); Q.Line[8] = true; };
|
||||
if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
|
||||
if (!Q.Line[9]) { DrawLine(Q[6], Q[2]); Q.Line[9] = true; };
|
||||
if (!Q.Line[1]) { DrawLine(Q[2], Q[1]); Q.Line[1] = true; };
|
||||
}
|
||||
Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
|
||||
Q.LastPx = 0;
|
||||
}
|
||||
|
||||
function Loop() {
|
||||
if (Testing.LoopCount > Testing.LoopMax) return;
|
||||
var TestingStr = String(Testing.LoopCount);
|
||||
while (TestingStr.length < 3) TestingStr = "0" + TestingStr;
|
||||
MTrans = Translate(I, -Q[8].V[0], -Q[8].V[1], -Q[8].V[2]);
|
||||
MTrans = RotateX(MTrans, 1);
|
||||
MTrans = RotateY(MTrans, 3);
|
||||
MTrans = RotateZ(MTrans, 5);
|
||||
MTrans = Translate(MTrans, Q[8].V[0], Q[8].V[1], Q[8].V[2]);
|
||||
MQube = MMulti(MTrans, MQube);
|
||||
var i = 8;
|
||||
for (; i > -1; i--) {
|
||||
Q[i].V = VMulti(MTrans, Q[i].V);
|
||||
}
|
||||
DrawQube();
|
||||
Testing.LoopCount++;
|
||||
Loop();
|
||||
}
|
||||
|
||||
function Init(CubeSize) {
|
||||
// init/reset vars
|
||||
Origin.V = [150,150,20,1];
|
||||
Testing.LoopCount = 0;
|
||||
Testing.LoopMax = 50;
|
||||
Testing.TimeMax = 0;
|
||||
Testing.TimeAvg = 0;
|
||||
Testing.TimeMin = 0;
|
||||
Testing.TimeTemp = 0;
|
||||
Testing.TimeTotal = 0;
|
||||
Testing.Init = false;
|
||||
|
||||
// transformation matrix
|
||||
MTrans = [
|
||||
[1,0,0,0],
|
||||
[0,1,0,0],
|
||||
[0,0,1,0],
|
||||
[0,0,0,1]
|
||||
];
|
||||
|
||||
// position information of qube
|
||||
MQube = [
|
||||
[1,0,0,0],
|
||||
[0,1,0,0],
|
||||
[0,0,1,0],
|
||||
[0,0,0,1]
|
||||
];
|
||||
|
||||
// entity matrix
|
||||
I = [
|
||||
[1,0,0,0],
|
||||
[0,1,0,0],
|
||||
[0,0,1,0],
|
||||
[0,0,0,1]
|
||||
];
|
||||
|
||||
// create qube
|
||||
Q[0] = new CreateP(-CubeSize,-CubeSize, CubeSize);
|
||||
Q[1] = new CreateP(-CubeSize, CubeSize, CubeSize);
|
||||
Q[2] = new CreateP( CubeSize, CubeSize, CubeSize);
|
||||
Q[3] = new CreateP( CubeSize,-CubeSize, CubeSize);
|
||||
Q[4] = new CreateP(-CubeSize,-CubeSize,-CubeSize);
|
||||
Q[5] = new CreateP(-CubeSize, CubeSize,-CubeSize);
|
||||
Q[6] = new CreateP( CubeSize, CubeSize,-CubeSize);
|
||||
Q[7] = new CreateP( CubeSize,-CubeSize,-CubeSize);
|
||||
|
||||
// center of gravity
|
||||
Q[8] = new CreateP(0, 0, 0);
|
||||
|
||||
// anti-clockwise edge check
|
||||
Q.Edge = [[0,1,2],[3,2,6],[7,6,5],[4,5,1],[4,0,3],[1,5,6]];
|
||||
|
||||
// calculate squad normals
|
||||
Q.Normal = new Array();
|
||||
for (var i = 0; i < Q.Edge.length; i++) Q.Normal[i] = CalcNormal(Q[Q.Edge[i][0]].V, Q[Q.Edge[i][1]].V, Q[Q.Edge[i][2]].V);
|
||||
|
||||
// line drawn ?
|
||||
Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
|
||||
|
||||
// create line pixels
|
||||
Q.NumPx = 9 * 2 * CubeSize;
|
||||
for (var i = 0; i < Q.NumPx; i++) CreateP(0,0,0);
|
||||
|
||||
MTrans = Translate(MTrans, Origin.V[0], Origin.V[1], Origin.V[2]);
|
||||
MQube = MMulti(MTrans, MQube);
|
||||
|
||||
var i = 0;
|
||||
for (; i < 9; i++) {
|
||||
Q[i].V = VMulti(MTrans, Q[i].V);
|
||||
}
|
||||
DrawQube();
|
||||
Testing.Init = true;
|
||||
Loop();
|
||||
}
|
||||
|
||||
for ( var i = 20; i <= 160; i *= 2 ) {
|
||||
Init(i);
|
||||
}
|
||||
|
||||
var actual = '';
|
||||
for (var i = 0; i < Q.length; ++i) {
|
||||
actual += Q[i].V + ';';
|
||||
}
|
||||
var expected = "-116.618229186398,212.51135212951073,62.5094191967962,1;127.83701023614447,417.11611179082263,90.41153816299942,1;293.9570894432935,196.58093046570656,252.17789153139591,1;49.501850020750915,-8.02382919560505,224.275772565193,1;6.042910556709444,103.41906953429206,-212.1778915313964,1;250.49814997925202,308.02382919560387,-184.27577256519325,1;416.61822918640064,87.48864787048812,-22.509419196796493,1;172.1629897638581,-117.1161117908236,-50.41153816299975,1;150.0000000000007,149.99999999999952,20,1;";
|
||||
assertEq(actual, expected);
|
||||
|
||||
Q = null;
|
||||
MTrans = null;
|
||||
MQube = null;
|
||||
I = null;
|
||||
Origin = null;
|
||||
Testing = null;
|
||||
LoopTime = null;
|
||||
DisplArea = null;
|
||||
|
|
@ -0,0 +1,424 @@
|
|||
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
|
||||
|
||||
/*
|
||||
* AES Cipher function: encrypt 'input' with Rijndael algorithm
|
||||
*
|
||||
* takes byte-array 'input' (16 bytes)
|
||||
* 2D byte-array key schedule 'w' (Nr+1 x Nb bytes)
|
||||
*
|
||||
* applies Nr rounds (10/12/14) using key schedule w for 'add round key' stage
|
||||
*
|
||||
* returns byte-array encrypted value (16 bytes)
|
||||
*/
|
||||
function Cipher(input, w) { // main Cipher function [§5.1]
|
||||
var Nb = 4; // block size (in words): no of columns in state (fixed at 4 for AES)
|
||||
var Nr = w.length/Nb - 1; // no of rounds: 10/12/14 for 128/192/256-bit keys
|
||||
|
||||
var state = [[],[],[],[]]; // initialise 4xNb byte-array 'state' with input [§3.4]
|
||||
for (var i=0; i<4*Nb; i++) state[i%4][Math.floor(i/4)] = input[i];
|
||||
|
||||
state = AddRoundKey(state, w, 0, Nb);
|
||||
|
||||
for (var round=1; round<Nr; round++) {
|
||||
state = SubBytes(state, Nb);
|
||||
state = ShiftRows(state, Nb);
|
||||
state = MixColumns(state, Nb);
|
||||
state = AddRoundKey(state, w, round, Nb);
|
||||
}
|
||||
|
||||
state = SubBytes(state, Nb);
|
||||
state = ShiftRows(state, Nb);
|
||||
state = AddRoundKey(state, w, Nr, Nb);
|
||||
|
||||
var output = new Array(4*Nb); // convert state to 1-d array before returning [§3.4]
|
||||
for (var i=0; i<4*Nb; i++) output[i] = state[i%4][Math.floor(i/4)];
|
||||
return output;
|
||||
}
|
||||
|
||||
|
||||
function SubBytes(s, Nb) { // apply SBox to state S [§5.1.1]
|
||||
for (var r=0; r<4; r++) {
|
||||
for (var c=0; c<Nb; c++) s[r][c] = Sbox[s[r][c]];
|
||||
}
|
||||
return s;
|
||||
}
|
||||
|
||||
|
||||
function ShiftRows(s, Nb) { // shift row r of state S left by r bytes [§5.1.2]
|
||||
var t = new Array(4);
|
||||
for (var r=1; r<4; r++) {
|
||||
for (var c=0; c<4; c++) t[c] = s[r][(c+r)%Nb]; // shift into temp copy
|
||||
for (var c=0; c<4; c++) s[r][c] = t[c]; // and copy back
|
||||
} // note that this will work for Nb=4,5,6, but not 7,8 (always 4 for AES):
|
||||
return s; // see fp.gladman.plus.com/cryptography_technology/rijndael/aes.spec.311.pdf
|
||||
}
|
||||
|
||||
|
||||
function MixColumns(s, Nb) { // combine bytes of each col of state S [§5.1.3]
|
||||
for (var c=0; c<4; c++) {
|
||||
var a = new Array(4); // 'a' is a copy of the current column from 's'
|
||||
var b = new Array(4); // 'b' is a•{02} in GF(2^8)
|
||||
for (var i=0; i<4; i++) {
|
||||
a[i] = s[i][c];
|
||||
b[i] = s[i][c]&0x80 ? s[i][c]<<1 ^ 0x011b : s[i][c]<<1;
|
||||
}
|
||||
// a[n] ^ b[n] is a•{03} in GF(2^8)
|
||||
s[0][c] = b[0] ^ a[1] ^ b[1] ^ a[2] ^ a[3]; // 2*a0 + 3*a1 + a2 + a3
|
||||
s[1][c] = a[0] ^ b[1] ^ a[2] ^ b[2] ^ a[3]; // a0 * 2*a1 + 3*a2 + a3
|
||||
s[2][c] = a[0] ^ a[1] ^ b[2] ^ a[3] ^ b[3]; // a0 + a1 + 2*a2 + 3*a3
|
||||
s[3][c] = a[0] ^ b[0] ^ a[1] ^ a[2] ^ b[3]; // 3*a0 + a1 + a2 + 2*a3
|
||||
}
|
||||
return s;
|
||||
}
|
||||
|
||||
|
||||
function AddRoundKey(state, w, rnd, Nb) { // xor Round Key into state S [§5.1.4]
|
||||
for (var r=0; r<4; r++) {
|
||||
for (var c=0; c<Nb; c++) state[r][c] ^= w[rnd*4+c][r];
|
||||
}
|
||||
return state;
|
||||
}
|
||||
|
||||
|
||||
function KeyExpansion(key) { // generate Key Schedule (byte-array Nr+1 x Nb) from Key [§5.2]
|
||||
var Nb = 4; // block size (in words): no of columns in state (fixed at 4 for AES)
|
||||
var Nk = key.length/4 // key length (in words): 4/6/8 for 128/192/256-bit keys
|
||||
var Nr = Nk + 6; // no of rounds: 10/12/14 for 128/192/256-bit keys
|
||||
|
||||
var w = new Array(Nb*(Nr+1));
|
||||
var temp = new Array(4);
|
||||
|
||||
for (var i=0; i<Nk; i++) {
|
||||
var r = [key[4*i], key[4*i+1], key[4*i+2], key[4*i+3]];
|
||||
w[i] = r;
|
||||
}
|
||||
|
||||
for (var i=Nk; i<(Nb*(Nr+1)); i++) {
|
||||
w[i] = new Array(4);
|
||||
for (var t=0; t<4; t++) temp[t] = w[i-1][t];
|
||||
if (i % Nk == 0) {
|
||||
temp = SubWord(RotWord(temp));
|
||||
for (var t=0; t<4; t++) temp[t] ^= Rcon[i/Nk][t];
|
||||
} else if (Nk > 6 && i%Nk == 4) {
|
||||
temp = SubWord(temp);
|
||||
}
|
||||
for (var t=0; t<4; t++) w[i][t] = w[i-Nk][t] ^ temp[t];
|
||||
}
|
||||
|
||||
return w;
|
||||
}
|
||||
|
||||
function SubWord(w) { // apply SBox to 4-byte word w
|
||||
for (var i=0; i<4; i++) w[i] = Sbox[w[i]];
|
||||
return w;
|
||||
}
|
||||
|
||||
function RotWord(w) { // rotate 4-byte word w left by one byte
|
||||
w[4] = w[0];
|
||||
for (var i=0; i<4; i++) w[i] = w[i+1];
|
||||
return w;
|
||||
}
|
||||
|
||||
|
||||
// Sbox is pre-computed multiplicative inverse in GF(2^8) used in SubBytes and KeyExpansion [§5.1.1]
|
||||
var Sbox = [0x63,0x7c,0x77,0x7b,0xf2,0x6b,0x6f,0xc5,0x30,0x01,0x67,0x2b,0xfe,0xd7,0xab,0x76,
|
||||
0xca,0x82,0xc9,0x7d,0xfa,0x59,0x47,0xf0,0xad,0xd4,0xa2,0xaf,0x9c,0xa4,0x72,0xc0,
|
||||
0xb7,0xfd,0x93,0x26,0x36,0x3f,0xf7,0xcc,0x34,0xa5,0xe5,0xf1,0x71,0xd8,0x31,0x15,
|
||||
0x04,0xc7,0x23,0xc3,0x18,0x96,0x05,0x9a,0x07,0x12,0x80,0xe2,0xeb,0x27,0xb2,0x75,
|
||||
0x09,0x83,0x2c,0x1a,0x1b,0x6e,0x5a,0xa0,0x52,0x3b,0xd6,0xb3,0x29,0xe3,0x2f,0x84,
|
||||
0x53,0xd1,0x00,0xed,0x20,0xfc,0xb1,0x5b,0x6a,0xcb,0xbe,0x39,0x4a,0x4c,0x58,0xcf,
|
||||
0xd0,0xef,0xaa,0xfb,0x43,0x4d,0x33,0x85,0x45,0xf9,0x02,0x7f,0x50,0x3c,0x9f,0xa8,
|
||||
0x51,0xa3,0x40,0x8f,0x92,0x9d,0x38,0xf5,0xbc,0xb6,0xda,0x21,0x10,0xff,0xf3,0xd2,
|
||||
0xcd,0x0c,0x13,0xec,0x5f,0x97,0x44,0x17,0xc4,0xa7,0x7e,0x3d,0x64,0x5d,0x19,0x73,
|
||||
0x60,0x81,0x4f,0xdc,0x22,0x2a,0x90,0x88,0x46,0xee,0xb8,0x14,0xde,0x5e,0x0b,0xdb,
|
||||
0xe0,0x32,0x3a,0x0a,0x49,0x06,0x24,0x5c,0xc2,0xd3,0xac,0x62,0x91,0x95,0xe4,0x79,
|
||||
0xe7,0xc8,0x37,0x6d,0x8d,0xd5,0x4e,0xa9,0x6c,0x56,0xf4,0xea,0x65,0x7a,0xae,0x08,
|
||||
0xba,0x78,0x25,0x2e,0x1c,0xa6,0xb4,0xc6,0xe8,0xdd,0x74,0x1f,0x4b,0xbd,0x8b,0x8a,
|
||||
0x70,0x3e,0xb5,0x66,0x48,0x03,0xf6,0x0e,0x61,0x35,0x57,0xb9,0x86,0xc1,0x1d,0x9e,
|
||||
0xe1,0xf8,0x98,0x11,0x69,0xd9,0x8e,0x94,0x9b,0x1e,0x87,0xe9,0xce,0x55,0x28,0xdf,
|
||||
0x8c,0xa1,0x89,0x0d,0xbf,0xe6,0x42,0x68,0x41,0x99,0x2d,0x0f,0xb0,0x54,0xbb,0x16];
|
||||
|
||||
// Rcon is Round Constant used for the Key Expansion [1st col is 2^(r-1) in GF(2^8)] [§5.2]
|
||||
var Rcon = [ [0x00, 0x00, 0x00, 0x00],
|
||||
[0x01, 0x00, 0x00, 0x00],
|
||||
[0x02, 0x00, 0x00, 0x00],
|
||||
[0x04, 0x00, 0x00, 0x00],
|
||||
[0x08, 0x00, 0x00, 0x00],
|
||||
[0x10, 0x00, 0x00, 0x00],
|
||||
[0x20, 0x00, 0x00, 0x00],
|
||||
[0x40, 0x00, 0x00, 0x00],
|
||||
[0x80, 0x00, 0x00, 0x00],
|
||||
[0x1b, 0x00, 0x00, 0x00],
|
||||
[0x36, 0x00, 0x00, 0x00] ];
|
||||
|
||||
|
||||
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
|
||||
|
||||
/*
|
||||
* Use AES to encrypt 'plaintext' with 'password' using 'nBits' key, in 'Counter' mode of operation
|
||||
* - see http://csrc.nist.gov/publications/nistpubs/800-38a/sp800-38a.pdf
|
||||
* for each block
|
||||
* - outputblock = cipher(counter, key)
|
||||
* - cipherblock = plaintext xor outputblock
|
||||
*/
|
||||
function AESEncryptCtr(plaintext, password, nBits) {
|
||||
if (!(nBits==128 || nBits==192 || nBits==256)) return ''; // standard allows 128/192/256 bit keys
|
||||
|
||||
// for this example script, generate the key by applying Cipher to 1st 16/24/32 chars of password;
|
||||
// for real-world applications, a more secure approach would be to hash the password e.g. with SHA-1
|
||||
var nBytes = nBits/8; // no bytes in key
|
||||
var pwBytes = new Array(nBytes);
|
||||
for (var i=0; i<nBytes; i++) pwBytes[i] = password.charCodeAt(i) & 0xff;
|
||||
var key = Cipher(pwBytes, KeyExpansion(pwBytes));
|
||||
key = key.concat(key.slice(0, nBytes-16)); // key is now 16/24/32 bytes long
|
||||
|
||||
// initialise counter block (NIST SP800-38A §B.2): millisecond time-stamp for nonce in 1st 8 bytes,
|
||||
// block counter in 2nd 8 bytes
|
||||
var blockSize = 16; // block size fixed at 16 bytes / 128 bits (Nb=4) for AES
|
||||
var counterBlock = new Array(blockSize); // block size fixed at 16 bytes / 128 bits (Nb=4) for AES
|
||||
var nonce = (new Date()).getTime(); // milliseconds since 1-Jan-1970
|
||||
|
||||
// encode nonce in two stages to cater for JavaScript 32-bit limit on bitwise ops
|
||||
for (var i=0; i<4; i++) counterBlock[i] = (nonce >>> i*8) & 0xff;
|
||||
for (var i=0; i<4; i++) counterBlock[i+4] = (nonce/0x100000000 >>> i*8) & 0xff;
|
||||
|
||||
// generate key schedule - an expansion of the key into distinct Key Rounds for each round
|
||||
var keySchedule = KeyExpansion(key);
|
||||
|
||||
var blockCount = Math.ceil(plaintext.length/blockSize);
|
||||
var ciphertext = new Array(blockCount); // ciphertext as array of strings
|
||||
|
||||
for (var b=0; b<blockCount; b++) {
|
||||
// set counter (block #) in last 8 bytes of counter block (leaving nonce in 1st 8 bytes)
|
||||
// again done in two stages for 32-bit ops
|
||||
for (var c=0; c<4; c++) counterBlock[15-c] = (b >>> c*8) & 0xff;
|
||||
for (var c=0; c<4; c++) counterBlock[15-c-4] = (b/0x100000000 >>> c*8)
|
||||
|
||||
var cipherCntr = Cipher(counterBlock, keySchedule); // -- encrypt counter block --
|
||||
|
||||
// calculate length of final block:
|
||||
var blockLength = b<blockCount-1 ? blockSize : (plaintext.length-1)%blockSize+1;
|
||||
|
||||
var ct = '';
|
||||
for (var i=0; i<blockLength; i++) { // -- xor plaintext with ciphered counter byte-by-byte --
|
||||
var plaintextByte = plaintext.charCodeAt(b*blockSize+i);
|
||||
var cipherByte = plaintextByte ^ cipherCntr[i];
|
||||
ct += String.fromCharCode(cipherByte);
|
||||
}
|
||||
// ct is now ciphertext for this block
|
||||
|
||||
ciphertext[b] = escCtrlChars(ct); // escape troublesome characters in ciphertext
|
||||
}
|
||||
|
||||
// convert the nonce to a string to go on the front of the ciphertext
|
||||
var ctrTxt = '';
|
||||
for (var i=0; i<8; i++) ctrTxt += String.fromCharCode(counterBlock[i]);
|
||||
ctrTxt = escCtrlChars(ctrTxt);
|
||||
|
||||
// use '-' to separate blocks, use Array.join to concatenate arrays of strings for efficiency
|
||||
return ctrTxt + '-' + ciphertext.join('-');
|
||||
}
|
||||
|
||||
|
||||
/*
|
||||
* Use AES to decrypt 'ciphertext' with 'password' using 'nBits' key, in Counter mode of operation
|
||||
*
|
||||
* for each block
|
||||
* - outputblock = cipher(counter, key)
|
||||
* - cipherblock = plaintext xor outputblock
|
||||
*/
|
||||
function AESDecryptCtr(ciphertext, password, nBits) {
|
||||
if (!(nBits==128 || nBits==192 || nBits==256)) return ''; // standard allows 128/192/256 bit keys
|
||||
|
||||
var nBytes = nBits/8; // no bytes in key
|
||||
var pwBytes = new Array(nBytes);
|
||||
for (var i=0; i<nBytes; i++) pwBytes[i] = password.charCodeAt(i) & 0xff;
|
||||
var pwKeySchedule = KeyExpansion(pwBytes);
|
||||
var key = Cipher(pwBytes, pwKeySchedule);
|
||||
key = key.concat(key.slice(0, nBytes-16)); // key is now 16/24/32 bytes long
|
||||
|
||||
var keySchedule = KeyExpansion(key);
|
||||
|
||||
ciphertext = ciphertext.split('-'); // split ciphertext into array of block-length strings
|
||||
|
||||
// recover nonce from 1st element of ciphertext
|
||||
var blockSize = 16; // block size fixed at 16 bytes / 128 bits (Nb=4) for AES
|
||||
var counterBlock = new Array(blockSize);
|
||||
var ctrTxt = unescCtrlChars(ciphertext[0]);
|
||||
for (var i=0; i<8; i++) counterBlock[i] = ctrTxt.charCodeAt(i);
|
||||
|
||||
var plaintext = new Array(ciphertext.length-1);
|
||||
|
||||
for (var b=1; b<ciphertext.length; b++) {
|
||||
// set counter (block #) in last 8 bytes of counter block (leaving nonce in 1st 8 bytes)
|
||||
for (var c=0; c<4; c++) counterBlock[15-c] = ((b-1) >>> c*8) & 0xff;
|
||||
for (var c=0; c<4; c++) counterBlock[15-c-4] = ((b/0x100000000-1) >>> c*8) & 0xff;
|
||||
|
||||
var cipherCntr = Cipher(counterBlock, keySchedule); // encrypt counter block
|
||||
|
||||
ciphertext[b] = unescCtrlChars(ciphertext[b]);
|
||||
|
||||
var pt = '';
|
||||
for (var i=0; i<ciphertext[b].length; i++) {
|
||||
// -- xor plaintext with ciphered counter byte-by-byte --
|
||||
var ciphertextByte = ciphertext[b].charCodeAt(i);
|
||||
var plaintextByte = ciphertextByte ^ cipherCntr[i];
|
||||
pt += String.fromCharCode(plaintextByte);
|
||||
}
|
||||
// pt is now plaintext for this block
|
||||
|
||||
plaintext[b-1] = pt; // b-1 'cos no initial nonce block in plaintext
|
||||
}
|
||||
|
||||
return plaintext.join('');
|
||||
}
|
||||
|
||||
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
|
||||
|
||||
function escCtrlChars(str) { // escape control chars which might cause problems handling ciphertext
|
||||
return str.replace(/[\0\t\n\v\f\r\xa0'"!-]/g, function(c) { return '!' + c.charCodeAt(0) + '!'; });
|
||||
} // \xa0 to cater for bug in Firefox; include '-' to leave it free for use as a block marker
|
||||
|
||||
function unescCtrlChars(str) { // unescape potentially problematic control characters
|
||||
return str.replace(/!\d\d?\d?!/g, function(c) { return String.fromCharCode(c.slice(1,-1)); });
|
||||
}
|
||||
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
|
||||
|
||||
/*
|
||||
* if escCtrlChars()/unescCtrlChars() still gives problems, use encodeBase64()/decodeBase64() instead
|
||||
*/
|
||||
var b64 = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/=";
|
||||
|
||||
function encodeBase64(str) { // http://tools.ietf.org/html/rfc4648
|
||||
var o1, o2, o3, h1, h2, h3, h4, bits, i=0, enc='';
|
||||
|
||||
str = encodeUTF8(str); // encode multi-byte chars into UTF-8 for byte-array
|
||||
|
||||
do { // pack three octets into four hexets
|
||||
o1 = str.charCodeAt(i++);
|
||||
o2 = str.charCodeAt(i++);
|
||||
o3 = str.charCodeAt(i++);
|
||||
|
||||
bits = o1<<16 | o2<<8 | o3;
|
||||
|
||||
h1 = bits>>18 & 0x3f;
|
||||
h2 = bits>>12 & 0x3f;
|
||||
h3 = bits>>6 & 0x3f;
|
||||
h4 = bits & 0x3f;
|
||||
|
||||
// end of string? index to '=' in b64
|
||||
if (isNaN(o3)) h4 = 64;
|
||||
if (isNaN(o2)) h3 = 64;
|
||||
|
||||
// use hexets to index into b64, and append result to encoded string
|
||||
enc += b64.charAt(h1) + b64.charAt(h2) + b64.charAt(h3) + b64.charAt(h4);
|
||||
} while (i < str.length);
|
||||
|
||||
return enc;
|
||||
}
|
||||
|
||||
function decodeBase64(str) {
|
||||
var o1, o2, o3, h1, h2, h3, h4, bits, i=0, enc='';
|
||||
|
||||
do { // unpack four hexets into three octets using index points in b64
|
||||
h1 = b64.indexOf(str.charAt(i++));
|
||||
h2 = b64.indexOf(str.charAt(i++));
|
||||
h3 = b64.indexOf(str.charAt(i++));
|
||||
h4 = b64.indexOf(str.charAt(i++));
|
||||
|
||||
bits = h1<<18 | h2<<12 | h3<<6 | h4;
|
||||
|
||||
o1 = bits>>16 & 0xff;
|
||||
o2 = bits>>8 & 0xff;
|
||||
o3 = bits & 0xff;
|
||||
|
||||
if (h3 == 64) enc += String.fromCharCode(o1);
|
||||
else if (h4 == 64) enc += String.fromCharCode(o1, o2);
|
||||
else enc += String.fromCharCode(o1, o2, o3);
|
||||
} while (i < str.length);
|
||||
|
||||
return decodeUTF8(enc); // decode UTF-8 byte-array back to Unicode
|
||||
}
|
||||
|
||||
function encodeUTF8(str) { // encode multi-byte string into utf-8 multiple single-byte characters
|
||||
str = str.replace(
|
||||
/[\u0080-\u07ff]/g, // U+0080 - U+07FF = 2-byte chars
|
||||
function(c) {
|
||||
var cc = c.charCodeAt(0);
|
||||
return String.fromCharCode(0xc0 | cc>>6, 0x80 | cc&0x3f); }
|
||||
);
|
||||
str = str.replace(
|
||||
/[\u0800-\uffff]/g, // U+0800 - U+FFFF = 3-byte chars
|
||||
function(c) {
|
||||
var cc = c.charCodeAt(0);
|
||||
return String.fromCharCode(0xe0 | cc>>12, 0x80 | cc>>6&0x3F, 0x80 | cc&0x3f); }
|
||||
);
|
||||
return str;
|
||||
}
|
||||
|
||||
function decodeUTF8(str) { // decode utf-8 encoded string back into multi-byte characters
|
||||
str = str.replace(
|
||||
/[\u00c0-\u00df][\u0080-\u00bf]/g, // 2-byte chars
|
||||
function(c) {
|
||||
var cc = (c.charCodeAt(0)&0x1f)<<6 | c.charCodeAt(1)&0x3f;
|
||||
return String.fromCharCode(cc); }
|
||||
);
|
||||
str = str.replace(
|
||||
/[\u00e0-\u00ef][\u0080-\u00bf][\u0080-\u00bf]/g, // 3-byte chars
|
||||
function(c) {
|
||||
var cc = (c.charCodeAt(0)&0x0f)<<12 | (c.charCodeAt(1)&0x3f<<6) | c.charCodeAt(2)&0x3f;
|
||||
return String.fromCharCode(cc); }
|
||||
);
|
||||
return str;
|
||||
}
|
||||
|
||||
|
||||
function byteArrayToHexStr(b) { // convert byte array to hex string for displaying test vectors
|
||||
var s = '';
|
||||
for (var i=0; i<b.length; i++) s += b[i].toString(16) + ' ';
|
||||
return s;
|
||||
}
|
||||
|
||||
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
|
||||
|
||||
|
||||
var plainText = "ROMEO: But, soft! what light through yonder window breaks?\n\
|
||||
It is the east, and Juliet is the sun.\n\
|
||||
Arise, fair sun, and kill the envious moon,\n\
|
||||
Who is already sick and pale with grief,\n\
|
||||
That thou her maid art far more fair than she:\n\
|
||||
Be not her maid, since she is envious;\n\
|
||||
Her vestal livery is but sick and green\n\
|
||||
And none but fools do wear it; cast it off.\n\
|
||||
It is my lady, O, it is my love!\n\
|
||||
O, that she knew she were!\n\
|
||||
She speaks yet she says nothing: what of that?\n\
|
||||
Her eye discourses; I will answer it.\n\
|
||||
I am too bold, 'tis not to me she speaks:\n\
|
||||
Two of the fairest stars in all the heaven,\n\
|
||||
Having some business, do entreat her eyes\n\
|
||||
To twinkle in their spheres till they return.\n\
|
||||
What if her eyes were there, they in her head?\n\
|
||||
The brightness of her cheek would shame those stars,\n\
|
||||
As daylight doth a lamp; her eyes in heaven\n\
|
||||
Would through the airy region stream so bright\n\
|
||||
That birds would sing and think it were not night.\n\
|
||||
See, how she leans her cheek upon her hand!\n\
|
||||
O, that I were a glove upon that hand,\n\
|
||||
That I might touch that cheek!\n\
|
||||
JULIET: Ay me!\n\
|
||||
ROMEO: She speaks:\n\
|
||||
O, speak again, bright angel! for thou art\n\
|
||||
As glorious to this night, being o'er my head\n\
|
||||
As is a winged messenger of heaven\n\
|
||||
Unto the white-upturned wondering eyes\n\
|
||||
Of mortals that fall back to gaze on him\n\
|
||||
When he bestrides the lazy-pacing clouds\n\
|
||||
And sails upon the bosom of the air.";
|
||||
|
||||
var password = "O Romeo, Romeo! wherefore art thou Romeo?";
|
||||
|
||||
var cipherText = AESEncryptCtr(plainText, password, 256);
|
||||
var decryptedText = AESDecryptCtr(cipherText, password, 256);
|
||||
|
||||
assertEq(plainText, decryptedText);
|
|
@ -0,0 +1,287 @@
|
|||
/*
|
||||
* A JavaScript implementation of the RSA Data Security, Inc. MD5 Message
|
||||
* Digest Algorithm, as defined in RFC 1321.
|
||||
* Version 2.1 Copyright (C) Paul Johnston 1999 - 2002.
|
||||
* Other contributors: Greg Holt, Andrew Kepert, Ydnar, Lostinet
|
||||
* Distributed under the BSD License
|
||||
* See http://pajhome.org.uk/crypt/md5 for more info.
|
||||
*/
|
||||
|
||||
/*
|
||||
* Configurable variables. You may need to tweak these to be compatible with
|
||||
* the server-side, but the defaults work in most cases.
|
||||
*/
|
||||
var hexcase = 0; /* hex output format. 0 - lowercase; 1 - uppercase */
|
||||
var b64pad = ""; /* base-64 pad character. "=" for strict RFC compliance */
|
||||
var chrsz = 8; /* bits per input character. 8 - ASCII; 16 - Unicode */
|
||||
|
||||
/*
|
||||
* These are the functions you'll usually want to call
|
||||
* They take string arguments and return either hex or base-64 encoded strings
|
||||
*/
|
||||
function hex_md5(s){ return binl2hex(core_md5(str2binl(s), s.length * chrsz));}
|
||||
function b64_md5(s){ return binl2b64(core_md5(str2binl(s), s.length * chrsz));}
|
||||
function str_md5(s){ return binl2str(core_md5(str2binl(s), s.length * chrsz));}
|
||||
function hex_hmac_md5(key, data) { return binl2hex(core_hmac_md5(key, data)); }
|
||||
function b64_hmac_md5(key, data) { return binl2b64(core_hmac_md5(key, data)); }
|
||||
function str_hmac_md5(key, data) { return binl2str(core_hmac_md5(key, data)); }
|
||||
|
||||
/*
|
||||
* Perform a simple self-test to see if the VM is working
|
||||
*/
|
||||
function md5_vm_test()
|
||||
{
|
||||
return hex_md5("abc") == "900150983cd24fb0d6963f7d28e17f72";
|
||||
}
|
||||
|
||||
/*
|
||||
* Calculate the MD5 of an array of little-endian words, and a bit length
|
||||
*/
|
||||
function core_md5(x, len)
|
||||
{
|
||||
/* append padding */
|
||||
x[len >> 5] |= 0x80 << ((len) % 32);
|
||||
x[(((len + 64) >>> 9) << 4) + 14] = len;
|
||||
|
||||
var a = 1732584193;
|
||||
var b = -271733879;
|
||||
var c = -1732584194;
|
||||
var d = 271733878;
|
||||
|
||||
for(var i = 0; i < x.length; i += 16)
|
||||
{
|
||||
var olda = a;
|
||||
var oldb = b;
|
||||
var oldc = c;
|
||||
var oldd = d;
|
||||
|
||||
a = md5_ff(a, b, c, d, x[i+ 0], 7 , -680876936);
|
||||
d = md5_ff(d, a, b, c, x[i+ 1], 12, -389564586);
|
||||
c = md5_ff(c, d, a, b, x[i+ 2], 17, 606105819);
|
||||
b = md5_ff(b, c, d, a, x[i+ 3], 22, -1044525330);
|
||||
a = md5_ff(a, b, c, d, x[i+ 4], 7 , -176418897);
|
||||
d = md5_ff(d, a, b, c, x[i+ 5], 12, 1200080426);
|
||||
c = md5_ff(c, d, a, b, x[i+ 6], 17, -1473231341);
|
||||
b = md5_ff(b, c, d, a, x[i+ 7], 22, -45705983);
|
||||
a = md5_ff(a, b, c, d, x[i+ 8], 7 , 1770035416);
|
||||
d = md5_ff(d, a, b, c, x[i+ 9], 12, -1958414417);
|
||||
c = md5_ff(c, d, a, b, x[i+10], 17, -42063);
|
||||
b = md5_ff(b, c, d, a, x[i+11], 22, -1990404162);
|
||||
a = md5_ff(a, b, c, d, x[i+12], 7 , 1804603682);
|
||||
d = md5_ff(d, a, b, c, x[i+13], 12, -40341101);
|
||||
c = md5_ff(c, d, a, b, x[i+14], 17, -1502002290);
|
||||
b = md5_ff(b, c, d, a, x[i+15], 22, 1236535329);
|
||||
|
||||
a = md5_gg(a, b, c, d, x[i+ 1], 5 , -165796510);
|
||||
d = md5_gg(d, a, b, c, x[i+ 6], 9 , -1069501632);
|
||||
c = md5_gg(c, d, a, b, x[i+11], 14, 643717713);
|
||||
b = md5_gg(b, c, d, a, x[i+ 0], 20, -373897302);
|
||||
a = md5_gg(a, b, c, d, x[i+ 5], 5 , -701558691);
|
||||
d = md5_gg(d, a, b, c, x[i+10], 9 , 38016083);
|
||||
c = md5_gg(c, d, a, b, x[i+15], 14, -660478335);
|
||||
b = md5_gg(b, c, d, a, x[i+ 4], 20, -405537848);
|
||||
a = md5_gg(a, b, c, d, x[i+ 9], 5 , 568446438);
|
||||
d = md5_gg(d, a, b, c, x[i+14], 9 , -1019803690);
|
||||
c = md5_gg(c, d, a, b, x[i+ 3], 14, -187363961);
|
||||
b = md5_gg(b, c, d, a, x[i+ 8], 20, 1163531501);
|
||||
a = md5_gg(a, b, c, d, x[i+13], 5 , -1444681467);
|
||||
d = md5_gg(d, a, b, c, x[i+ 2], 9 , -51403784);
|
||||
c = md5_gg(c, d, a, b, x[i+ 7], 14, 1735328473);
|
||||
b = md5_gg(b, c, d, a, x[i+12], 20, -1926607734);
|
||||
|
||||
a = md5_hh(a, b, c, d, x[i+ 5], 4 , -378558);
|
||||
d = md5_hh(d, a, b, c, x[i+ 8], 11, -2022574463);
|
||||
c = md5_hh(c, d, a, b, x[i+11], 16, 1839030562);
|
||||
b = md5_hh(b, c, d, a, x[i+14], 23, -35309556);
|
||||
a = md5_hh(a, b, c, d, x[i+ 1], 4 , -1530992060);
|
||||
d = md5_hh(d, a, b, c, x[i+ 4], 11, 1272893353);
|
||||
c = md5_hh(c, d, a, b, x[i+ 7], 16, -155497632);
|
||||
b = md5_hh(b, c, d, a, x[i+10], 23, -1094730640);
|
||||
a = md5_hh(a, b, c, d, x[i+13], 4 , 681279174);
|
||||
d = md5_hh(d, a, b, c, x[i+ 0], 11, -358537222);
|
||||
c = md5_hh(c, d, a, b, x[i+ 3], 16, -722521979);
|
||||
b = md5_hh(b, c, d, a, x[i+ 6], 23, 76029189);
|
||||
a = md5_hh(a, b, c, d, x[i+ 9], 4 , -640364487);
|
||||
d = md5_hh(d, a, b, c, x[i+12], 11, -421815835);
|
||||
c = md5_hh(c, d, a, b, x[i+15], 16, 530742520);
|
||||
b = md5_hh(b, c, d, a, x[i+ 2], 23, -995338651);
|
||||
|
||||
a = md5_ii(a, b, c, d, x[i+ 0], 6 , -198630844);
|
||||
d = md5_ii(d, a, b, c, x[i+ 7], 10, 1126891415);
|
||||
c = md5_ii(c, d, a, b, x[i+14], 15, -1416354905);
|
||||
b = md5_ii(b, c, d, a, x[i+ 5], 21, -57434055);
|
||||
a = md5_ii(a, b, c, d, x[i+12], 6 , 1700485571);
|
||||
d = md5_ii(d, a, b, c, x[i+ 3], 10, -1894986606);
|
||||
c = md5_ii(c, d, a, b, x[i+10], 15, -1051523);
|
||||
b = md5_ii(b, c, d, a, x[i+ 1], 21, -2054922799);
|
||||
a = md5_ii(a, b, c, d, x[i+ 8], 6 , 1873313359);
|
||||
d = md5_ii(d, a, b, c, x[i+15], 10, -30611744);
|
||||
c = md5_ii(c, d, a, b, x[i+ 6], 15, -1560198380);
|
||||
b = md5_ii(b, c, d, a, x[i+13], 21, 1309151649);
|
||||
a = md5_ii(a, b, c, d, x[i+ 4], 6 , -145523070);
|
||||
d = md5_ii(d, a, b, c, x[i+11], 10, -1120210379);
|
||||
c = md5_ii(c, d, a, b, x[i+ 2], 15, 718787259);
|
||||
b = md5_ii(b, c, d, a, x[i+ 9], 21, -343485551);
|
||||
|
||||
a = safe_add(a, olda);
|
||||
b = safe_add(b, oldb);
|
||||
c = safe_add(c, oldc);
|
||||
d = safe_add(d, oldd);
|
||||
}
|
||||
return Array(a, b, c, d);
|
||||
|
||||
}
|
||||
|
||||
/*
|
||||
* These functions implement the four basic operations the algorithm uses.
|
||||
*/
|
||||
function md5_cmn(q, a, b, x, s, t)
|
||||
{
|
||||
return safe_add(bit_rol(safe_add(safe_add(a, q), safe_add(x, t)), s),b);
|
||||
}
|
||||
function md5_ff(a, b, c, d, x, s, t)
|
||||
{
|
||||
return md5_cmn((b & c) | ((~b) & d), a, b, x, s, t);
|
||||
}
|
||||
function md5_gg(a, b, c, d, x, s, t)
|
||||
{
|
||||
return md5_cmn((b & d) | (c & (~d)), a, b, x, s, t);
|
||||
}
|
||||
function md5_hh(a, b, c, d, x, s, t)
|
||||
{
|
||||
return md5_cmn(b ^ c ^ d, a, b, x, s, t);
|
||||
}
|
||||
function md5_ii(a, b, c, d, x, s, t)
|
||||
{
|
||||
return md5_cmn(c ^ (b | (~d)), a, b, x, s, t);
|
||||
}
|
||||
|
||||
/*
|
||||
* Calculate the HMAC-MD5, of a key and some data
|
||||
*/
|
||||
function core_hmac_md5(key, data)
|
||||
{
|
||||
var bkey = str2binl(key);
|
||||
if(bkey.length > 16) bkey = core_md5(bkey, key.length * chrsz);
|
||||
|
||||
var ipad = Array(16), opad = Array(16);
|
||||
for(var i = 0; i < 16; i++)
|
||||
{
|
||||
ipad[i] = bkey[i] ^ 0x36363636;
|
||||
opad[i] = bkey[i] ^ 0x5C5C5C5C;
|
||||
}
|
||||
|
||||
var hash = core_md5(ipad.concat(str2binl(data)), 512 + data.length * chrsz);
|
||||
return core_md5(opad.concat(hash), 512 + 128);
|
||||
}
|
||||
|
||||
/*
|
||||
* Add integers, wrapping at 2^32. This uses 16-bit operations internally
|
||||
* to work around bugs in some JS interpreters.
|
||||
*/
|
||||
function safe_add(x, y)
|
||||
{
|
||||
var lsw = (x & 0xFFFF) + (y & 0xFFFF);
|
||||
var msw = (x >> 16) + (y >> 16) + (lsw >> 16);
|
||||
return (msw << 16) | (lsw & 0xFFFF);
|
||||
}
|
||||
|
||||
/*
|
||||
* Bitwise rotate a 32-bit number to the left.
|
||||
*/
|
||||
function bit_rol(num, cnt)
|
||||
{
|
||||
return (num << cnt) | (num >>> (32 - cnt));
|
||||
}
|
||||
|
||||
/*
|
||||
* Convert a string to an array of little-endian words
|
||||
* If chrsz is ASCII, characters >255 have their hi-byte silently ignored.
|
||||
*/
|
||||
function str2binl(str)
|
||||
{
|
||||
var bin = Array();
|
||||
var mask = (1 << chrsz) - 1;
|
||||
for(var i = 0; i < str.length * chrsz; i += chrsz)
|
||||
bin[i>>5] |= (str.charCodeAt(i / chrsz) & mask) << (i%32);
|
||||
return bin;
|
||||
}
|
||||
|
||||
/*
|
||||
* Convert an array of little-endian words to a string
|
||||
*/
|
||||
function binl2str(bin)
|
||||
{
|
||||
var str = "";
|
||||
var mask = (1 << chrsz) - 1;
|
||||
for(var i = 0; i < bin.length * 32; i += chrsz)
|
||||
str += String.fromCharCode((bin[i>>5] >>> (i % 32)) & mask);
|
||||
return str;
|
||||
}
|
||||
|
||||
/*
|
||||
* Convert an array of little-endian words to a hex string.
|
||||
*/
|
||||
function binl2hex(binarray)
|
||||
{
|
||||
var hex_tab = hexcase ? "0123456789ABCDEF" : "0123456789abcdef";
|
||||
var str = "";
|
||||
for(var i = 0; i < binarray.length * 4; i++)
|
||||
{
|
||||
str += hex_tab.charAt((binarray[i>>2] >> ((i%4)*8+4)) & 0xF) +
|
||||
hex_tab.charAt((binarray[i>>2] >> ((i%4)*8 )) & 0xF);
|
||||
}
|
||||
return str;
|
||||
}
|
||||
|
||||
/*
|
||||
* Convert an array of little-endian words to a base-64 string
|
||||
*/
|
||||
function binl2b64(binarray)
|
||||
{
|
||||
var tab = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/";
|
||||
var str = "";
|
||||
for(var i = 0; i < binarray.length * 4; i += 3)
|
||||
{
|
||||
var triplet = (((binarray[i >> 2] >> 8 * ( i %4)) & 0xFF) << 16)
|
||||
| (((binarray[i+1 >> 2] >> 8 * ((i+1)%4)) & 0xFF) << 8 )
|
||||
| ((binarray[i+2 >> 2] >> 8 * ((i+2)%4)) & 0xFF);
|
||||
for(var j = 0; j < 4; j++)
|
||||
{
|
||||
if(i * 8 + j * 6 > binarray.length * 32) str += b64pad;
|
||||
else str += tab.charAt((triplet >> 6*(3-j)) & 0x3F);
|
||||
}
|
||||
}
|
||||
return str;
|
||||
}
|
||||
|
||||
var plainText = "Rebellious subjects, enemies to peace,\n\
|
||||
Profaners of this neighbour-stained steel,--\n\
|
||||
Will they not hear? What, ho! you men, you beasts,\n\
|
||||
That quench the fire of your pernicious rage\n\
|
||||
With purple fountains issuing from your veins,\n\
|
||||
On pain of torture, from those bloody hands\n\
|
||||
Throw your mistemper'd weapons to the ground,\n\
|
||||
And hear the sentence of your moved prince.\n\
|
||||
Three civil brawls, bred of an airy word,\n\
|
||||
By thee, old Capulet, and Montague,\n\
|
||||
Have thrice disturb'd the quiet of our streets,\n\
|
||||
And made Verona's ancient citizens\n\
|
||||
Cast by their grave beseeming ornaments,\n\
|
||||
To wield old partisans, in hands as old,\n\
|
||||
Canker'd with peace, to part your canker'd hate:\n\
|
||||
If ever you disturb our streets again,\n\
|
||||
Your lives shall pay the forfeit of the peace.\n\
|
||||
For this time, all the rest depart away:\n\
|
||||
You Capulet; shall go along with me:\n\
|
||||
And, Montague, come you this afternoon,\n\
|
||||
To know our further pleasure in this case,\n\
|
||||
To old Free-town, our common judgment-place.\n\
|
||||
Once more, on pain of death, all men depart."
|
||||
|
||||
for (var i = 0; i <4; i++) {
|
||||
plainText += plainText;
|
||||
}
|
||||
|
||||
var md5Output = hex_md5(plainText);
|
||||
assertEq(md5Output, "a831e91e0f70eddcb70dc61c6f82f6cd")
|
|
@ -0,0 +1,225 @@
|
|||
/*
|
||||
* A JavaScript implementation of the Secure Hash Algorithm, SHA-1, as defined
|
||||
* in FIPS PUB 180-1
|
||||
* Version 2.1a Copyright Paul Johnston 2000 - 2002.
|
||||
* Other contributors: Greg Holt, Andrew Kepert, Ydnar, Lostinet
|
||||
* Distributed under the BSD License
|
||||
* See http://pajhome.org.uk/crypt/md5 for details.
|
||||
*/
|
||||
|
||||
/*
|
||||
* Configurable variables. You may need to tweak these to be compatible with
|
||||
* the server-side, but the defaults work in most cases.
|
||||
*/
|
||||
var hexcase = 0; /* hex output format. 0 - lowercase; 1 - uppercase */
|
||||
var b64pad = ""; /* base-64 pad character. "=" for strict RFC compliance */
|
||||
var chrsz = 8; /* bits per input character. 8 - ASCII; 16 - Unicode */
|
||||
|
||||
/*
|
||||
* These are the functions you'll usually want to call
|
||||
* They take string arguments and return either hex or base-64 encoded strings
|
||||
*/
|
||||
function hex_sha1(s){return binb2hex(core_sha1(str2binb(s),s.length * chrsz));}
|
||||
function b64_sha1(s){return binb2b64(core_sha1(str2binb(s),s.length * chrsz));}
|
||||
function str_sha1(s){return binb2str(core_sha1(str2binb(s),s.length * chrsz));}
|
||||
function hex_hmac_sha1(key, data){ return binb2hex(core_hmac_sha1(key, data));}
|
||||
function b64_hmac_sha1(key, data){ return binb2b64(core_hmac_sha1(key, data));}
|
||||
function str_hmac_sha1(key, data){ return binb2str(core_hmac_sha1(key, data));}
|
||||
|
||||
/*
|
||||
* Perform a simple self-test to see if the VM is working
|
||||
*/
|
||||
function sha1_vm_test()
|
||||
{
|
||||
return hex_sha1("abc") == "a9993e364706816aba3e25717850c26c9cd0d89d";
|
||||
}
|
||||
|
||||
/*
|
||||
* Calculate the SHA-1 of an array of big-endian words, and a bit length
|
||||
*/
|
||||
function core_sha1(x, len)
|
||||
{
|
||||
/* append padding */
|
||||
x[len >> 5] |= 0x80 << (24 - len % 32);
|
||||
x[((len + 64 >> 9) << 4) + 15] = len;
|
||||
|
||||
var w = Array(80);
|
||||
var a = 1732584193;
|
||||
var b = -271733879;
|
||||
var c = -1732584194;
|
||||
var d = 271733878;
|
||||
var e = -1009589776;
|
||||
|
||||
for(var i = 0; i < x.length; i += 16)
|
||||
{
|
||||
var olda = a;
|
||||
var oldb = b;
|
||||
var oldc = c;
|
||||
var oldd = d;
|
||||
var olde = e;
|
||||
|
||||
for(var j = 0; j < 80; j++)
|
||||
{
|
||||
if(j < 16) w[j] = x[i + j];
|
||||
else w[j] = rol(w[j-3] ^ w[j-8] ^ w[j-14] ^ w[j-16], 1);
|
||||
var t = safe_add(safe_add(rol(a, 5), sha1_ft(j, b, c, d)),
|
||||
safe_add(safe_add(e, w[j]), sha1_kt(j)));
|
||||
e = d;
|
||||
d = c;
|
||||
c = rol(b, 30);
|
||||
b = a;
|
||||
a = t;
|
||||
}
|
||||
|
||||
a = safe_add(a, olda);
|
||||
b = safe_add(b, oldb);
|
||||
c = safe_add(c, oldc);
|
||||
d = safe_add(d, oldd);
|
||||
e = safe_add(e, olde);
|
||||
}
|
||||
return Array(a, b, c, d, e);
|
||||
|
||||
}
|
||||
|
||||
/*
|
||||
* Perform the appropriate triplet combination function for the current
|
||||
* iteration
|
||||
*/
|
||||
function sha1_ft(t, b, c, d)
|
||||
{
|
||||
if(t < 20) return (b & c) | ((~b) & d);
|
||||
if(t < 40) return b ^ c ^ d;
|
||||
if(t < 60) return (b & c) | (b & d) | (c & d);
|
||||
return b ^ c ^ d;
|
||||
}
|
||||
|
||||
/*
|
||||
* Determine the appropriate additive constant for the current iteration
|
||||
*/
|
||||
function sha1_kt(t)
|
||||
{
|
||||
return (t < 20) ? 1518500249 : (t < 40) ? 1859775393 :
|
||||
(t < 60) ? -1894007588 : -899497514;
|
||||
}
|
||||
|
||||
/*
|
||||
* Calculate the HMAC-SHA1 of a key and some data
|
||||
*/
|
||||
function core_hmac_sha1(key, data)
|
||||
{
|
||||
var bkey = str2binb(key);
|
||||
if(bkey.length > 16) bkey = core_sha1(bkey, key.length * chrsz);
|
||||
|
||||
var ipad = Array(16), opad = Array(16);
|
||||
for(var i = 0; i < 16; i++)
|
||||
{
|
||||
ipad[i] = bkey[i] ^ 0x36363636;
|
||||
opad[i] = bkey[i] ^ 0x5C5C5C5C;
|
||||
}
|
||||
|
||||
var hash = core_sha1(ipad.concat(str2binb(data)), 512 + data.length * chrsz);
|
||||
return core_sha1(opad.concat(hash), 512 + 160);
|
||||
}
|
||||
|
||||
/*
|
||||
* Add integers, wrapping at 2^32. This uses 16-bit operations internally
|
||||
* to work around bugs in some JS interpreters.
|
||||
*/
|
||||
function safe_add(x, y)
|
||||
{
|
||||
var lsw = (x & 0xFFFF) + (y & 0xFFFF);
|
||||
var msw = (x >> 16) + (y >> 16) + (lsw >> 16);
|
||||
return (msw << 16) | (lsw & 0xFFFF);
|
||||
}
|
||||
|
||||
/*
|
||||
* Bitwise rotate a 32-bit number to the left.
|
||||
*/
|
||||
function rol(num, cnt)
|
||||
{
|
||||
return (num << cnt) | (num >>> (32 - cnt));
|
||||
}
|
||||
|
||||
/*
|
||||
* Convert an 8-bit or 16-bit string to an array of big-endian words
|
||||
* In 8-bit function, characters >255 have their hi-byte silently ignored.
|
||||
*/
|
||||
function str2binb(str)
|
||||
{
|
||||
var bin = Array();
|
||||
var mask = (1 << chrsz) - 1;
|
||||
for(var i = 0; i < str.length * chrsz; i += chrsz)
|
||||
bin[i>>5] |= (str.charCodeAt(i / chrsz) & mask) << (32 - chrsz - i%32);
|
||||
return bin;
|
||||
}
|
||||
|
||||
/*
|
||||
* Convert an array of big-endian words to a string
|
||||
*/
|
||||
function binb2str(bin)
|
||||
{
|
||||
var str = "";
|
||||
var mask = (1 << chrsz) - 1;
|
||||
for(var i = 0; i < bin.length * 32; i += chrsz)
|
||||
str += String.fromCharCode((bin[i>>5] >>> (32 - chrsz - i%32)) & mask);
|
||||
return str;
|
||||
}
|
||||
|
||||
/*
|
||||
* Convert an array of big-endian words to a hex string.
|
||||
*/
|
||||
function binb2hex(binarray)
|
||||
{
|
||||
var hex_tab = hexcase ? "0123456789ABCDEF" : "0123456789abcdef";
|
||||
var str = "";
|
||||
for(var i = 0; i < binarray.length * 4; i++)
|
||||
{
|
||||
str += hex_tab.charAt((binarray[i>>2] >> ((3 - i%4)*8+4)) & 0xF) +
|
||||
hex_tab.charAt((binarray[i>>2] >> ((3 - i%4)*8 )) & 0xF);
|
||||
}
|
||||
return str;
|
||||
}
|
||||
|
||||
/*
|
||||
* Convert an array of big-endian words to a base-64 string
|
||||
*/
|
||||
function binb2b64(binarray)
|
||||
{
|
||||
var tab = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/";
|
||||
var str = "";
|
||||
for(var i = 0; i < binarray.length * 4; i += 3)
|
||||
{
|
||||
var triplet = (((binarray[i >> 2] >> 8 * (3 - i %4)) & 0xFF) << 16)
|
||||
| (((binarray[i+1 >> 2] >> 8 * (3 - (i+1)%4)) & 0xFF) << 8 )
|
||||
| ((binarray[i+2 >> 2] >> 8 * (3 - (i+2)%4)) & 0xFF);
|
||||
for(var j = 0; j < 4; j++)
|
||||
{
|
||||
if(i * 8 + j * 6 > binarray.length * 32) str += b64pad;
|
||||
else str += tab.charAt((triplet >> 6*(3-j)) & 0x3F);
|
||||
}
|
||||
}
|
||||
return str;
|
||||
}
|
||||
|
||||
|
||||
var plainText = "Two households, both alike in dignity,\n\
|
||||
In fair Verona, where we lay our scene,\n\
|
||||
From ancient grudge break to new mutiny,\n\
|
||||
Where civil blood makes civil hands unclean.\n\
|
||||
From forth the fatal loins of these two foes\n\
|
||||
A pair of star-cross'd lovers take their life;\n\
|
||||
Whole misadventured piteous overthrows\n\
|
||||
Do with their death bury their parents' strife.\n\
|
||||
The fearful passage of their death-mark'd love,\n\
|
||||
And the continuance of their parents' rage,\n\
|
||||
Which, but their children's end, nought could remove,\n\
|
||||
Is now the two hours' traffic of our stage;\n\
|
||||
The which if you with patient ears attend,\n\
|
||||
What here shall miss, our toil shall strive to mend.";
|
||||
|
||||
for (var i = 0; i <4; i++) {
|
||||
plainText += plainText;
|
||||
}
|
||||
|
||||
var sha1Output = hex_sha1(plainText);
|
||||
assertEq(sha1Output, "2524d264def74cce2498bf112bedf00e6c0b796d")
|
|
@ -0,0 +1,100 @@
|
|||
/*
|
||||
* Copyright (C) Rich Moore. All rights reserved.
|
||||
*
|
||||
* Redistribution and use in source and binary forms, with or without
|
||||
* modification, are permitted provided that the following conditions
|
||||
* are met:
|
||||
* 1. Redistributions of source code must retain the above copyright
|
||||
* notice, this list of conditions and the following disclaimer.
|
||||
* 2. Redistributions in binary form must reproduce the above copyright
|
||||
* notice, this list of conditions and the following disclaimer in the
|
||||
* documentation and/or other materials provided with the distribution.
|
||||
*
|
||||
* THIS SOFTWARE IS PROVIDED BY CONTRIBUTORS ``AS IS'' AND ANY
|
||||
* EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
|
||||
* IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
|
||||
* PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR
|
||||
* CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
|
||||
* EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
|
||||
* PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
|
||||
* PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
|
||||
* OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
|
||||
* (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
|
||||
* OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
|
||||
*/
|
||||
|
||||
/////. Start CORDIC
|
||||
|
||||
var AG_CONST = 0.6072529350;
|
||||
|
||||
function FIXED(X)
|
||||
{
|
||||
return X * 65536.0;
|
||||
}
|
||||
|
||||
function FLOAT(X)
|
||||
{
|
||||
return X / 65536.0;
|
||||
}
|
||||
|
||||
function DEG2RAD(X)
|
||||
{
|
||||
return 0.017453 * (X);
|
||||
}
|
||||
|
||||
var Angles = [
|
||||
FIXED(45.0), FIXED(26.565), FIXED(14.0362), FIXED(7.12502),
|
||||
FIXED(3.57633), FIXED(1.78991), FIXED(0.895174), FIXED(0.447614),
|
||||
FIXED(0.223811), FIXED(0.111906), FIXED(0.055953),
|
||||
FIXED(0.027977)
|
||||
];
|
||||
|
||||
|
||||
function cordicsincos() {
|
||||
var X;
|
||||
var Y;
|
||||
var TargetAngle;
|
||||
var CurrAngle;
|
||||
var Step;
|
||||
|
||||
X = FIXED(AG_CONST); /* AG_CONST * cos(0) */
|
||||
Y = 0; /* AG_CONST * sin(0) */
|
||||
|
||||
TargetAngle = FIXED(28.027);
|
||||
CurrAngle = 0;
|
||||
for (Step = 0; Step < 12; Step++) {
|
||||
var NewX;
|
||||
if (TargetAngle > CurrAngle) {
|
||||
NewX = X - (Y >> Step);
|
||||
Y = (X >> Step) + Y;
|
||||
X = NewX;
|
||||
CurrAngle += Angles[Step];
|
||||
} else {
|
||||
NewX = X + (Y >> Step);
|
||||
Y = -(X >> Step) + Y;
|
||||
X = NewX;
|
||||
CurrAngle -= Angles[Step];
|
||||
}
|
||||
}
|
||||
return CurrAngle;
|
||||
}
|
||||
|
||||
///// End CORDIC
|
||||
|
||||
function cordic( runs ) {
|
||||
var actual;
|
||||
|
||||
var start = new Date();
|
||||
|
||||
for ( var i = 0 ; i < runs ; i++ ) {
|
||||
actual = cordicsincos();
|
||||
}
|
||||
|
||||
var end = new Date();
|
||||
|
||||
assertEq(actual, 1834995.3515519998)
|
||||
|
||||
return end.getTime() - start.getTime();
|
||||
}
|
||||
|
||||
cordic(25000);
|
|
@ -0,0 +1,36 @@
|
|||
// The Computer Language Shootout
|
||||
// http://shootout.alioth.debian.org/
|
||||
// contributed by Isaac Gouy
|
||||
|
||||
function partial(n){
|
||||
var a1 = a2 = a3 = a4 = a5 = a6 = a7 = a8 = a9 = 0.0;
|
||||
var twothirds = 2.0/3.0;
|
||||
var alt = -1.0;
|
||||
var k2 = k3 = sk = ck = 0.0;
|
||||
|
||||
for (var k = 1; k <= n; k++){
|
||||
k2 = k*k;
|
||||
k3 = k2*k;
|
||||
sk = Math.sin(k);
|
||||
ck = Math.cos(k);
|
||||
alt = -alt;
|
||||
|
||||
a1 += Math.pow(twothirds,k-1);
|
||||
a2 += Math.pow(k,-0.5);
|
||||
a3 += 1.0/(k*(k+1.0));
|
||||
a4 += 1.0/(k3 * sk*sk);
|
||||
a5 += 1.0/(k3 * ck*ck);
|
||||
a6 += 1.0/k;
|
||||
a7 += 1.0/k2;
|
||||
a8 += alt/k;
|
||||
a9 += alt/(2*k -1);
|
||||
}
|
||||
|
||||
return [ a1, a2, a3, a4, a5, a6, a7, a8, a9 ].join(',');
|
||||
}
|
||||
|
||||
var actual = '';
|
||||
for (var i = 1024; i <= 16384; i *= 2) {
|
||||
actual += partial(i) + ';';
|
||||
}
|
||||
assertEq(actual, "2.9999999999999987,62.555269219624684,0.9990243902439033,30.174793391263677,42.99468748637077,7.509175672278132,1.6439579810301654,0.6926591377284127,0.785154022830656;2.9999999999999987,89.06036157695789,0.9995119570522216,30.30796333494624,42.99485339033617,8.202078771817716,1.6444459047881168,0.6929030995395857,0.7852760930922243;2.9999999999999987,126.54745783224483,0.999755918965097,30.314167756318135,42.994888939123,8.89510389696629,1.6446899560231332,0.6930251251486118,0.7853371282421086;2.9999999999999987,179.56450569047874,0.9998779445868421,30.314499725429847,42.99489723774016,9.588190046095265,1.644812003986005,0.693086149128997,0.785367645819433;2.9999999999999987,254.54355172132264,0.9999389685688135,30.31451920492601,42.99489939769195,10.281306710008463,1.6448730335545856,0.6931166639131536,0.7853829046083998;")
|
|
@ -0,0 +1,53 @@
|
|||
// The Great Computer Language Shootout
|
||||
// http://shootout.alioth.debian.org/
|
||||
//
|
||||
// contributed by Ian Osgood
|
||||
|
||||
function A(i,j) {
|
||||
return 1/((i+j)*(i+j+1)/2+i+1);
|
||||
}
|
||||
|
||||
function Au(u,v) {
|
||||
for (var i=0; i<u.length; ++i) {
|
||||
var t = 0;
|
||||
for (var j=0; j<u.length; ++j)
|
||||
t += A(i,j) * u[j];
|
||||
v[i] = t;
|
||||
}
|
||||
}
|
||||
|
||||
function Atu(u,v) {
|
||||
for (var i=0; i<u.length; ++i) {
|
||||
var t = 0;
|
||||
for (var j=0; j<u.length; ++j)
|
||||
t += A(j,i) * u[j];
|
||||
v[i] = t;
|
||||
}
|
||||
}
|
||||
|
||||
function AtAu(u,v,w) {
|
||||
Au(u,w);
|
||||
Atu(w,v);
|
||||
}
|
||||
|
||||
function spectralnorm(n) {
|
||||
var i, u=[], v=[], w=[], vv=0, vBv=0;
|
||||
for (i=0; i<n; ++i) {
|
||||
u[i] = 1; v[i] = w[i] = 0;
|
||||
}
|
||||
for (i=0; i<10; ++i) {
|
||||
AtAu(u,v,w);
|
||||
AtAu(v,u,w);
|
||||
}
|
||||
for (i=0; i<n; ++i) {
|
||||
vBv += u[i]*v[i];
|
||||
vv += v[i]*v[i];
|
||||
}
|
||||
return Math.sqrt(vBv/vv);
|
||||
}
|
||||
|
||||
var actual = '';
|
||||
for (var i = 6; i <= 48; i *= 2) {
|
||||
actual += spectralnorm(i) + ',';
|
||||
}
|
||||
assertEq(actual, "1.2657786149754053,1.2727355112619148,1.273989979775574,1.274190125290389,");
|
Разница между файлами не показана из-за своего большого размера
Загрузить разницу
|
@ -0,0 +1,90 @@
|
|||
// The Great Computer Language Shootout
|
||||
// http://shootout.alioth.debian.org
|
||||
//
|
||||
// Contributed by Ian Osgood
|
||||
|
||||
var last = 42, A = 3877, C = 29573, M = 139968;
|
||||
|
||||
function rand(max) {
|
||||
last = (last * A + C) % M;
|
||||
return max * last / M;
|
||||
}
|
||||
|
||||
var ALU =
|
||||
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
|
||||
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
|
||||
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
|
||||
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
|
||||
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
|
||||
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
|
||||
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
|
||||
|
||||
var IUB = {
|
||||
a:0.27, c:0.12, g:0.12, t:0.27,
|
||||
B:0.02, D:0.02, H:0.02, K:0.02,
|
||||
M:0.02, N:0.02, R:0.02, S:0.02,
|
||||
V:0.02, W:0.02, Y:0.02
|
||||
}
|
||||
|
||||
var HomoSap = {
|
||||
a: 0.3029549426680,
|
||||
c: 0.1979883004921,
|
||||
g: 0.1975473066391,
|
||||
t: 0.3015094502008
|
||||
}
|
||||
|
||||
function makeCumulative(table) {
|
||||
var last = null;
|
||||
for (var c in table) {
|
||||
if (last) table[c] += table[last];
|
||||
last = c;
|
||||
}
|
||||
}
|
||||
|
||||
function fastaRepeat(n, seq) {
|
||||
var seqi = 0, lenOut = 60;
|
||||
while (n>0) {
|
||||
if (n<lenOut) lenOut = n;
|
||||
if (seqi + lenOut < seq.length) {
|
||||
ret = seq.substring(seqi, seqi+lenOut);
|
||||
seqi += lenOut;
|
||||
} else {
|
||||
var s = seq.substring(seqi);
|
||||
seqi = lenOut - s.length;
|
||||
ret = s + seq.substring(0, seqi);
|
||||
}
|
||||
n -= lenOut;
|
||||
}
|
||||
return ret;
|
||||
}
|
||||
|
||||
function fastaRandom(n, table) {
|
||||
var line = new Array(60);
|
||||
makeCumulative(table);
|
||||
while (n>0) {
|
||||
if (n<line.length) line = new Array(n);
|
||||
for (var i=0; i<line.length; i++) {
|
||||
var r = rand(1);
|
||||
for (var c in table) {
|
||||
if (r < table[c]) {
|
||||
line[i] = c;
|
||||
break;
|
||||
}
|
||||
}
|
||||
}
|
||||
ret = line.join('');
|
||||
n -= line.length;
|
||||
}
|
||||
return ret;
|
||||
}
|
||||
|
||||
var ret;
|
||||
|
||||
var count = 7;
|
||||
var actual1 = fastaRepeat(2*count*100000, ALU);
|
||||
var actual2 = fastaRandom(3*count*1000, IUB);
|
||||
var actual3 = fastaRandom(5*count*1000, HomoSap);
|
||||
|
||||
assertEq(actual1, "CAAAAAGGCCGGGCGCGGTG");
|
||||
assertEq(actual2, "VtttaDtKgcaaWaaaaatSccMcVatgtKgtaKgcgatatgtagtSaaaDttatacaaa");
|
||||
assertEq(actual3, "ttggctatatttatgttgga");
|
Различия файлов скрыты, потому что одна или несколько строк слишком длинны
Различия файлов скрыты, потому что одна или несколько строк слишком длинны
Загрузка…
Ссылка в новой задаче