mozilla
/
gecko-dev
зеркало из https://github.com/mozilla/gecko-dev.git
1
0
Форкнуть 0
Код Задачи Пакеты Проекты Релизы Вики Активность

Bug 549503: more SunSpider verification tests, r=dvander 

--HG--
extra : rebase_source : 15ebc76e6de2c982ca77bb6a271f691ddc8559a8
This commit is contained in:
David Mandelin 2010-03-01 17:40:01 -08:00
Родитель ffafb514ed
Коммит 8befd2ecbb
11 изменённых файлов: 3613 добавлений и 0 удалений
Показать статистику Скачать Patch файл Скачать Diff файл Показать все файлы Свернуть все файлы

345
js/src/trace-test/tests/sunspider/check-3d-cube.js Normal file
Просмотреть файл

@ -0,0 +1,345 @@
// 3D Cube Rotation
// http://www.speich.net/computer/moztesting/3d.htm
// Created by Simon Speich
var Q = new Array();
var MTrans = new Array(); // transformation matrix
var MQube = new Array(); // position information of qube
var I = new Array(); // entity matrix
var Origin = new Object();
var Testing = new Object();
var LoopTimer;
var DisplArea = new Object();
DisplArea.Width = 300;
DisplArea.Height = 300;
function DrawLine(From, To) {
var x1 = From.V[0];
var x2 = To.V[0];
var y1 = From.V[1];
var y2 = To.V[1];
var dx = Math.abs(x2 - x1);
var dy = Math.abs(y2 - y1);
var x = x1;
var y = y1;
var IncX1, IncY1;
var IncX2, IncY2;
var Den;
var Num;
var NumAdd;
var NumPix;
if (x2 >= x1) { IncX1 = 1; IncX2 = 1; }
else { IncX1 = -1; IncX2 = -1; }
if (y2 >= y1) { IncY1 = 1; IncY2 = 1; }
else { IncY1 = -1; IncY2 = -1; }
if (dx >= dy) {
IncX1 = 0;
IncY2 = 0;
Den = dx;
Num = dx / 2;
NumAdd = dy;
NumPix = dx;
}
else {
IncX2 = 0;
IncY1 = 0;
Den = dy;
Num = dy / 2;
NumAdd = dx;
NumPix = dy;
}
NumPix = Math.round(Q.LastPx + NumPix);
var i = Q.LastPx;
for (; i < NumPix; i++) {
Num += NumAdd;
if (Num >= Den) {
Num -= Den;
x += IncX1;
y += IncY1;
}
x += IncX2;
y += IncY2;
}
Q.LastPx = NumPix;
}
function CalcCross(V0, V1) {
var Cross = new Array();
Cross[0] = V0[1]*V1[2] - V0[2]*V1[1];
Cross[1] = V0[2]*V1[0] - V0[0]*V1[2];
Cross[2] = V0[0]*V1[1] - V0[1]*V1[0];
return Cross;
}
function CalcNormal(V0, V1, V2) {
var A = new Array(); var B = new Array();
for (var i = 0; i < 3; i++) {
A[i] = V0[i] - V1[i];
B[i] = V2[i] - V1[i];
}
A = CalcCross(A, B);
var Length = Math.sqrt(A[0]*A[0] + A[1]*A[1] + A[2]*A[2]);
for (var i = 0; i < 3; i++) A[i] = A[i] / Length;
A[3] = 1;
return A;
}
function CreateP(X,Y,Z) {
this.V = [X,Y,Z,1];
}
// multiplies two matrices
function MMulti(M1, M2) {
var M = [[],[],[],[]];
var i = 0;
var j = 0;
for (; i < 4; i++) {
j = 0;
for (; j < 4; j++) M[i][j] = M1[i][0] * M2[0][j] + M1[i][1] * M2[1][j] + M1[i][2] * M2[2][j] + M1[i][3] * M2[3][j];
}
return M;
}
//multiplies matrix with vector
function VMulti(M, V) {
var Vect = new Array();
var i = 0;
for (;i < 4; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2] + M[i][3] * V[3];
return Vect;
}
function VMulti2(M, V) {
var Vect = new Array();
var i = 0;
for (;i < 3; i++) Vect[i] = M[i][0] * V[0] + M[i][1] * V[1] + M[i][2] * V[2];
return Vect;
}
// add to matrices
function MAdd(M1, M2) {
var M = [[],[],[],[]];
var i = 0;
var j = 0;
for (; i < 4; i++) {
j = 0;
for (; j < 4; j++) M[i][j] = M1[i][j] + M2[i][j];
}
return M;
}
function Translate(M, Dx, Dy, Dz) {
var T = [
[1,0,0,Dx],
[0,1,0,Dy],
[0,0,1,Dz],
[0,0,0,1]
];
return MMulti(T, M);
}
function RotateX(M, Phi) {
var a = Phi;
a *= Math.PI / 180;
var Cos = Math.cos(a);
var Sin = Math.sin(a);
var R = [
[1,0,0,0],
[0,Cos,-Sin,0],
[0,Sin,Cos,0],
[0,0,0,1]
];
return MMulti(R, M);
}
function RotateY(M, Phi) {
var a = Phi;
a *= Math.PI / 180;
var Cos = Math.cos(a);
var Sin = Math.sin(a);
var R = [
[Cos,0,Sin,0],
[0,1,0,0],
[-Sin,0,Cos,0],
[0,0,0,1]
];
return MMulti(R, M);
}
function RotateZ(M, Phi) {
var a = Phi;
a *= Math.PI / 180;
var Cos = Math.cos(a);
var Sin = Math.sin(a);
var R = [
[Cos,-Sin,0,0],
[Sin,Cos,0,0],
[0,0,1,0],
[0,0,0,1]
];
return MMulti(R, M);
}
function DrawQube() {
// calc current normals
var CurN = new Array();
var i = 5;
Q.LastPx = 0;
for (; i > -1; i--) CurN[i] = VMulti2(MQube, Q.Normal[i]);
if (CurN[0][2] < 0) {
if (!Q.Line[0]) { DrawLine(Q[0], Q[1]); Q.Line[0] = true; };
if (!Q.Line[1]) { DrawLine(Q[1], Q[2]); Q.Line[1] = true; };
if (!Q.Line[2]) { DrawLine(Q[2], Q[3]); Q.Line[2] = true; };
if (!Q.Line[3]) { DrawLine(Q[3], Q[0]); Q.Line[3] = true; };
}
if (CurN[1][2] < 0) {
if (!Q.Line[2]) { DrawLine(Q[3], Q[2]); Q.Line[2] = true; };
if (!Q.Line[9]) { DrawLine(Q[2], Q[6]); Q.Line[9] = true; };
if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
if (!Q.Line[10]) { DrawLine(Q[7], Q[3]); Q.Line[10] = true; };
}
if (CurN[2][2] < 0) {
if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
if (!Q.Line[6]) { DrawLine(Q[6], Q[7]); Q.Line[6] = true; };
if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
}
if (CurN[3][2] < 0) {
if (!Q.Line[4]) { DrawLine(Q[4], Q[5]); Q.Line[4] = true; };
if (!Q.Line[8]) { DrawLine(Q[5], Q[1]); Q.Line[8] = true; };
if (!Q.Line[0]) { DrawLine(Q[1], Q[0]); Q.Line[0] = true; };
if (!Q.Line[11]) { DrawLine(Q[0], Q[4]); Q.Line[11] = true; };
}
if (CurN[4][2] < 0) {
if (!Q.Line[11]) { DrawLine(Q[4], Q[0]); Q.Line[11] = true; };
if (!Q.Line[3]) { DrawLine(Q[0], Q[3]); Q.Line[3] = true; };
if (!Q.Line[10]) { DrawLine(Q[3], Q[7]); Q.Line[10] = true; };
if (!Q.Line[7]) { DrawLine(Q[7], Q[4]); Q.Line[7] = true; };
}
if (CurN[5][2] < 0) {
if (!Q.Line[8]) { DrawLine(Q[1], Q[5]); Q.Line[8] = true; };
if (!Q.Line[5]) { DrawLine(Q[5], Q[6]); Q.Line[5] = true; };
if (!Q.Line[9]) { DrawLine(Q[6], Q[2]); Q.Line[9] = true; };
if (!Q.Line[1]) { DrawLine(Q[2], Q[1]); Q.Line[1] = true; };
}
Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
Q.LastPx = 0;
}
function Loop() {
if (Testing.LoopCount > Testing.LoopMax) return;
var TestingStr = String(Testing.LoopCount);
while (TestingStr.length < 3) TestingStr = "0" + TestingStr;
MTrans = Translate(I, -Q[8].V[0], -Q[8].V[1], -Q[8].V[2]);
MTrans = RotateX(MTrans, 1);
MTrans = RotateY(MTrans, 3);
MTrans = RotateZ(MTrans, 5);
MTrans = Translate(MTrans, Q[8].V[0], Q[8].V[1], Q[8].V[2]);
MQube = MMulti(MTrans, MQube);
var i = 8;
for (; i > -1; i--) {
Q[i].V = VMulti(MTrans, Q[i].V);
}
DrawQube();
Testing.LoopCount++;
Loop();
}
function Init(CubeSize) {
// init/reset vars
Origin.V = [150,150,20,1];
Testing.LoopCount = 0;
Testing.LoopMax = 50;
Testing.TimeMax = 0;
Testing.TimeAvg = 0;
Testing.TimeMin = 0;
Testing.TimeTemp = 0;
Testing.TimeTotal = 0;
Testing.Init = false;
// transformation matrix
MTrans = [
[1,0,0,0],
[0,1,0,0],
[0,0,1,0],
[0,0,0,1]
];
// position information of qube
MQube = [
[1,0,0,0],
[0,1,0,0],
[0,0,1,0],
[0,0,0,1]
];
// entity matrix
I = [
[1,0,0,0],
[0,1,0,0],
[0,0,1,0],
[0,0,0,1]
];
// create qube
Q[0] = new CreateP(-CubeSize,-CubeSize, CubeSize);
Q[1] = new CreateP(-CubeSize, CubeSize, CubeSize);
Q[2] = new CreateP( CubeSize, CubeSize, CubeSize);
Q[3] = new CreateP( CubeSize,-CubeSize, CubeSize);
Q[4] = new CreateP(-CubeSize,-CubeSize,-CubeSize);
Q[5] = new CreateP(-CubeSize, CubeSize,-CubeSize);
Q[6] = new CreateP( CubeSize, CubeSize,-CubeSize);
Q[7] = new CreateP( CubeSize,-CubeSize,-CubeSize);
// center of gravity
Q[8] = new CreateP(0, 0, 0);
// anti-clockwise edge check
Q.Edge = [[0,1,2],[3,2,6],[7,6,5],[4,5,1],[4,0,3],[1,5,6]];
// calculate squad normals
Q.Normal = new Array();
for (var i = 0; i < Q.Edge.length; i++) Q.Normal[i] = CalcNormal(Q[Q.Edge[i][0]].V, Q[Q.Edge[i][1]].V, Q[Q.Edge[i][2]].V);
// line drawn ?
Q.Line = [false,false,false,false,false,false,false,false,false,false,false,false];
// create line pixels
Q.NumPx = 9 * 2 * CubeSize;
for (var i = 0; i < Q.NumPx; i++) CreateP(0,0,0);
MTrans = Translate(MTrans, Origin.V[0], Origin.V[1], Origin.V[2]);
MQube = MMulti(MTrans, MQube);
var i = 0;
for (; i < 9; i++) {
Q[i].V = VMulti(MTrans, Q[i].V);
}
DrawQube();
Testing.Init = true;
Loop();
}
for ( var i = 20; i <= 160; i *= 2 ) {
Init(i);
}
var actual = '';
for (var i = 0; i < Q.length; ++i) {
actual += Q[i].V + ';';
}
var expected = "-116.618229186398,212.51135212951073,62.5094191967962,1;127.83701023614447,417.11611179082263,90.41153816299942,1;293.9570894432935,196.58093046570656,252.17789153139591,1;49.501850020750915,-8.02382919560505,224.275772565193,1;6.042910556709444,103.41906953429206,-212.1778915313964,1;250.49814997925202,308.02382919560387,-184.27577256519325,1;416.61822918640064,87.48864787048812,-22.509419196796493,1;172.1629897638581,-117.1161117908236,-50.41153816299975,1;150.0000000000007,149.99999999999952,20,1;";
assertEq(actual, expected);
Q = null;
MTrans = null;
MQube = null;
I = null;
Origin = null;
Testing = null;
LoopTime = null;
DisplArea = null;

424
js/src/trace-test/tests/sunspider/check-crypto-aes.js Normal file
Просмотреть файл

@ -0,0 +1,424 @@
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
/*
* AES Cipher function: encrypt 'input' with Rijndael algorithm
*
* takes byte-array 'input' (16 bytes)
* 2D byte-array key schedule 'w' (Nr+1 x Nb bytes)
*
* applies Nr rounds (10/12/14) using key schedule w for 'add round key' stage
*
* returns byte-array encrypted value (16 bytes)
*/
function Cipher(input, w) { // main Cipher function [§5.1]
var Nb = 4; // block size (in words): no of columns in state (fixed at 4 for AES)
var Nr = w.length/Nb - 1; // no of rounds: 10/12/14 for 128/192/256-bit keys
var state = [[],[],[],[]]; // initialise 4xNb byte-array 'state' with input [§3.4]
for (var i=0; i<4*Nb; i++) state[i%4][Math.floor(i/4)] = input[i];
state = AddRoundKey(state, w, 0, Nb);
for (var round=1; round<Nr; round++) {
state = SubBytes(state, Nb);
state = ShiftRows(state, Nb);
state = MixColumns(state, Nb);
state = AddRoundKey(state, w, round, Nb);
}
state = SubBytes(state, Nb);
state = ShiftRows(state, Nb);
state = AddRoundKey(state, w, Nr, Nb);
var output = new Array(4*Nb); // convert state to 1-d array before returning [§3.4]
for (var i=0; i<4*Nb; i++) output[i] = state[i%4][Math.floor(i/4)];
return output;
}
function SubBytes(s, Nb) { // apply SBox to state S [§5.1.1]
for (var r=0; r<4; r++) {
for (var c=0; c<Nb; c++) s[r][c] = Sbox[s[r][c]];
}
return s;
}
function ShiftRows(s, Nb) { // shift row r of state S left by r bytes [§5.1.2]
var t = new Array(4);
for (var r=1; r<4; r++) {
for (var c=0; c<4; c++) t[c] = s[r][(c+r)%Nb]; // shift into temp copy
for (var c=0; c<4; c++) s[r][c] = t[c]; // and copy back
} // note that this will work for Nb=4,5,6, but not 7,8 (always 4 for AES):
return s; // see fp.gladman.plus.com/cryptography_technology/rijndael/aes.spec.311.pdf
}
function MixColumns(s, Nb) { // combine bytes of each col of state S [§5.1.3]
for (var c=0; c<4; c++) {
var a = new Array(4); // 'a' is a copy of the current column from 's'
var b = new Array(4); // 'b' is a•{02} in GF(2^8)
for (var i=0; i<4; i++) {
a[i] = s[i][c];
b[i] = s[i][c]&0x80 ? s[i][c]<<1 ^ 0x011b : s[i][c]<<1;
}
// a[n] ^ b[n] is a•{03} in GF(2^8)
s[0][c] = b[0] ^ a[1] ^ b[1] ^ a[2] ^ a[3]; // 2*a0 + 3*a1 + a2 + a3
s[1][c] = a[0] ^ b[1] ^ a[2] ^ b[2] ^ a[3]; // a0 * 2*a1 + 3*a2 + a3
s[2][c] = a[0] ^ a[1] ^ b[2] ^ a[3] ^ b[3]; // a0 + a1 + 2*a2 + 3*a3
s[3][c] = a[0] ^ b[0] ^ a[1] ^ a[2] ^ b[3]; // 3*a0 + a1 + a2 + 2*a3
}
return s;
}
function AddRoundKey(state, w, rnd, Nb) { // xor Round Key into state S [§5.1.4]
for (var r=0; r<4; r++) {
for (var c=0; c<Nb; c++) state[r][c] ^= w[rnd*4+c][r];
}
return state;
}
function KeyExpansion(key) { // generate Key Schedule (byte-array Nr+1 x Nb) from Key [§5.2]
var Nb = 4; // block size (in words): no of columns in state (fixed at 4 for AES)
var Nk = key.length/4 // key length (in words): 4/6/8 for 128/192/256-bit keys
var Nr = Nk + 6; // no of rounds: 10/12/14 for 128/192/256-bit keys
var w = new Array(Nb*(Nr+1));
var temp = new Array(4);
for (var i=0; i<Nk; i++) {
var r = [key[4*i], key[4*i+1], key[4*i+2], key[4*i+3]];
w[i] = r;
}
for (var i=Nk; i<(Nb*(Nr+1)); i++) {
w[i] = new Array(4);
for (var t=0; t<4; t++) temp[t] = w[i-1][t];
if (i % Nk == 0) {
temp = SubWord(RotWord(temp));
for (var t=0; t<4; t++) temp[t] ^= Rcon[i/Nk][t];
} else if (Nk > 6 && i%Nk == 4) {
temp = SubWord(temp);
}
for (var t=0; t<4; t++) w[i][t] = w[i-Nk][t] ^ temp[t];
}
return w;
}
function SubWord(w) { // apply SBox to 4-byte word w
for (var i=0; i<4; i++) w[i] = Sbox[w[i]];
return w;
}
function RotWord(w) { // rotate 4-byte word w left by one byte
w[4] = w[0];
for (var i=0; i<4; i++) w[i] = w[i+1];
return w;
}
// Sbox is pre-computed multiplicative inverse in GF(2^8) used in SubBytes and KeyExpansion [§5.1.1]
var Sbox = [0x63,0x7c,0x77,0x7b,0xf2,0x6b,0x6f,0xc5,0x30,0x01,0x67,0x2b,0xfe,0xd7,0xab,0x76,
0xca,0x82,0xc9,0x7d,0xfa,0x59,0x47,0xf0,0xad,0xd4,0xa2,0xaf,0x9c,0xa4,0x72,0xc0,
0xb7,0xfd,0x93,0x26,0x36,0x3f,0xf7,0xcc,0x34,0xa5,0xe5,0xf1,0x71,0xd8,0x31,0x15,
0x04,0xc7,0x23,0xc3,0x18,0x96,0x05,0x9a,0x07,0x12,0x80,0xe2,0xeb,0x27,0xb2,0x75,
0x09,0x83,0x2c,0x1a,0x1b,0x6e,0x5a,0xa0,0x52,0x3b,0xd6,0xb3,0x29,0xe3,0x2f,0x84,
0x53,0xd1,0x00,0xed,0x20,0xfc,0xb1,0x5b,0x6a,0xcb,0xbe,0x39,0x4a,0x4c,0x58,0xcf,
0xd0,0xef,0xaa,0xfb,0x43,0x4d,0x33,0x85,0x45,0xf9,0x02,0x7f,0x50,0x3c,0x9f,0xa8,
0x51,0xa3,0x40,0x8f,0x92,0x9d,0x38,0xf5,0xbc,0xb6,0xda,0x21,0x10,0xff,0xf3,0xd2,
0xcd,0x0c,0x13,0xec,0x5f,0x97,0x44,0x17,0xc4,0xa7,0x7e,0x3d,0x64,0x5d,0x19,0x73,
0x60,0x81,0x4f,0xdc,0x22,0x2a,0x90,0x88,0x46,0xee,0xb8,0x14,0xde,0x5e,0x0b,0xdb,
0xe0,0x32,0x3a,0x0a,0x49,0x06,0x24,0x5c,0xc2,0xd3,0xac,0x62,0x91,0x95,0xe4,0x79,
0xe7,0xc8,0x37,0x6d,0x8d,0xd5,0x4e,0xa9,0x6c,0x56,0xf4,0xea,0x65,0x7a,0xae,0x08,
0xba,0x78,0x25,0x2e,0x1c,0xa6,0xb4,0xc6,0xe8,0xdd,0x74,0x1f,0x4b,0xbd,0x8b,0x8a,
0x70,0x3e,0xb5,0x66,0x48,0x03,0xf6,0x0e,0x61,0x35,0x57,0xb9,0x86,0xc1,0x1d,0x9e,
0xe1,0xf8,0x98,0x11,0x69,0xd9,0x8e,0x94,0x9b,0x1e,0x87,0xe9,0xce,0x55,0x28,0xdf,
0x8c,0xa1,0x89,0x0d,0xbf,0xe6,0x42,0x68,0x41,0x99,0x2d,0x0f,0xb0,0x54,0xbb,0x16];
// Rcon is Round Constant used for the Key Expansion [1st col is 2^(r-1) in GF(2^8)] [§5.2]
var Rcon = [ [0x00, 0x00, 0x00, 0x00],
[0x01, 0x00, 0x00, 0x00],
[0x02, 0x00, 0x00, 0x00],
[0x04, 0x00, 0x00, 0x00],
[0x08, 0x00, 0x00, 0x00],
[0x10, 0x00, 0x00, 0x00],
[0x20, 0x00, 0x00, 0x00],
[0x40, 0x00, 0x00, 0x00],
[0x80, 0x00, 0x00, 0x00],
[0x1b, 0x00, 0x00, 0x00],
[0x36, 0x00, 0x00, 0x00] ];
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
/*
* Use AES to encrypt 'plaintext' with 'password' using 'nBits' key, in 'Counter' mode of operation
* - see http://csrc.nist.gov/publications/nistpubs/800-38a/sp800-38a.pdf
* for each block
* - outputblock = cipher(counter, key)
* - cipherblock = plaintext xor outputblock
*/
function AESEncryptCtr(plaintext, password, nBits) {
if (!(nBits==128 || nBits==192 || nBits==256)) return ''; // standard allows 128/192/256 bit keys
// for this example script, generate the key by applying Cipher to 1st 16/24/32 chars of password;
// for real-world applications, a more secure approach would be to hash the password e.g. with SHA-1
var nBytes = nBits/8; // no bytes in key
var pwBytes = new Array(nBytes);
for (var i=0; i<nBytes; i++) pwBytes[i] = password.charCodeAt(i) & 0xff;
var key = Cipher(pwBytes, KeyExpansion(pwBytes));
key = key.concat(key.slice(0, nBytes-16)); // key is now 16/24/32 bytes long
// initialise counter block (NIST SP800-38A §B.2): millisecond time-stamp for nonce in 1st 8 bytes,
// block counter in 2nd 8 bytes
var blockSize = 16; // block size fixed at 16 bytes / 128 bits (Nb=4) for AES
var counterBlock = new Array(blockSize); // block size fixed at 16 bytes / 128 bits (Nb=4) for AES
var nonce = (new Date()).getTime(); // milliseconds since 1-Jan-1970
// encode nonce in two stages to cater for JavaScript 32-bit limit on bitwise ops
for (var i=0; i<4; i++) counterBlock[i] = (nonce >>> i*8) & 0xff;
for (var i=0; i<4; i++) counterBlock[i+4] = (nonce/0x100000000 >>> i*8) & 0xff;
// generate key schedule - an expansion of the key into distinct Key Rounds for each round
var keySchedule = KeyExpansion(key);
var blockCount = Math.ceil(plaintext.length/blockSize);
var ciphertext = new Array(blockCount); // ciphertext as array of strings
for (var b=0; b<blockCount; b++) {
// set counter (block #) in last 8 bytes of counter block (leaving nonce in 1st 8 bytes)
// again done in two stages for 32-bit ops
for (var c=0; c<4; c++) counterBlock[15-c] = (b >>> c*8) & 0xff;
for (var c=0; c<4; c++) counterBlock[15-c-4] = (b/0x100000000 >>> c*8)
var cipherCntr = Cipher(counterBlock, keySchedule); // -- encrypt counter block --
// calculate length of final block:
var blockLength = b<blockCount-1 ? blockSize : (plaintext.length-1)%blockSize+1;
var ct = '';
for (var i=0; i<blockLength; i++) { // -- xor plaintext with ciphered counter byte-by-byte --
var plaintextByte = plaintext.charCodeAt(b*blockSize+i);
var cipherByte = plaintextByte ^ cipherCntr[i];
ct += String.fromCharCode(cipherByte);
}
// ct is now ciphertext for this block
ciphertext[b] = escCtrlChars(ct); // escape troublesome characters in ciphertext
}
// convert the nonce to a string to go on the front of the ciphertext
var ctrTxt = '';
for (var i=0; i<8; i++) ctrTxt += String.fromCharCode(counterBlock[i]);
ctrTxt = escCtrlChars(ctrTxt);
// use '-' to separate blocks, use Array.join to concatenate arrays of strings for efficiency
return ctrTxt + '-' + ciphertext.join('-');
}
/*
* Use AES to decrypt 'ciphertext' with 'password' using 'nBits' key, in Counter mode of operation
*
* for each block
* - outputblock = cipher(counter, key)
* - cipherblock = plaintext xor outputblock
*/
function AESDecryptCtr(ciphertext, password, nBits) {
if (!(nBits==128 || nBits==192 || nBits==256)) return ''; // standard allows 128/192/256 bit keys
var nBytes = nBits/8; // no bytes in key
var pwBytes = new Array(nBytes);
for (var i=0; i<nBytes; i++) pwBytes[i] = password.charCodeAt(i) & 0xff;
var pwKeySchedule = KeyExpansion(pwBytes);
var key = Cipher(pwBytes, pwKeySchedule);
key = key.concat(key.slice(0, nBytes-16)); // key is now 16/24/32 bytes long
var keySchedule = KeyExpansion(key);
ciphertext = ciphertext.split('-'); // split ciphertext into array of block-length strings
// recover nonce from 1st element of ciphertext
var blockSize = 16; // block size fixed at 16 bytes / 128 bits (Nb=4) for AES
var counterBlock = new Array(blockSize);
var ctrTxt = unescCtrlChars(ciphertext[0]);
for (var i=0; i<8; i++) counterBlock[i] = ctrTxt.charCodeAt(i);
var plaintext = new Array(ciphertext.length-1);
for (var b=1; b<ciphertext.length; b++) {
// set counter (block #) in last 8 bytes of counter block (leaving nonce in 1st 8 bytes)
for (var c=0; c<4; c++) counterBlock[15-c] = ((b-1) >>> c*8) & 0xff;
for (var c=0; c<4; c++) counterBlock[15-c-4] = ((b/0x100000000-1) >>> c*8) & 0xff;
var cipherCntr = Cipher(counterBlock, keySchedule); // encrypt counter block
ciphertext[b] = unescCtrlChars(ciphertext[b]);
var pt = '';
for (var i=0; i<ciphertext[b].length; i++) {
// -- xor plaintext with ciphered counter byte-by-byte --
var ciphertextByte = ciphertext[b].charCodeAt(i);
var plaintextByte = ciphertextByte ^ cipherCntr[i];
pt += String.fromCharCode(plaintextByte);
}
// pt is now plaintext for this block
plaintext[b-1] = pt; // b-1 'cos no initial nonce block in plaintext
}
return plaintext.join('');
}
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
function escCtrlChars(str) { // escape control chars which might cause problems handling ciphertext
return str.replace(/[\0\t\n\v\f\r\xa0'"!-]/g, function(c) { return '!' + c.charCodeAt(0) + '!'; });
} // \xa0 to cater for bug in Firefox; include '-' to leave it free for use as a block marker
function unescCtrlChars(str) { // unescape potentially problematic control characters
return str.replace(/!\d\d?\d?!/g, function(c) { return String.fromCharCode(c.slice(1,-1)); });
}
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
/*
* if escCtrlChars()/unescCtrlChars() still gives problems, use encodeBase64()/decodeBase64() instead
*/
var b64 = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/=";
function encodeBase64(str) { // http://tools.ietf.org/html/rfc4648
var o1, o2, o3, h1, h2, h3, h4, bits, i=0, enc='';
str = encodeUTF8(str); // encode multi-byte chars into UTF-8 for byte-array
do { // pack three octets into four hexets
o1 = str.charCodeAt(i++);
o2 = str.charCodeAt(i++);
o3 = str.charCodeAt(i++);
bits = o1<<16 | o2<<8 | o3;
h1 = bits>>18 & 0x3f;
h2 = bits>>12 & 0x3f;
h3 = bits>>6 & 0x3f;
h4 = bits & 0x3f;
// end of string? index to '=' in b64
if (isNaN(o3)) h4 = 64;
if (isNaN(o2)) h3 = 64;
// use hexets to index into b64, and append result to encoded string
enc += b64.charAt(h1) + b64.charAt(h2) + b64.charAt(h3) + b64.charAt(h4);
} while (i < str.length);
return enc;
}
function decodeBase64(str) {
var o1, o2, o3, h1, h2, h3, h4, bits, i=0, enc='';
do { // unpack four hexets into three octets using index points in b64
h1 = b64.indexOf(str.charAt(i++));
h2 = b64.indexOf(str.charAt(i++));
h3 = b64.indexOf(str.charAt(i++));
h4 = b64.indexOf(str.charAt(i++));
bits = h1<<18 | h2<<12 | h3<<6 | h4;
o1 = bits>>16 & 0xff;
o2 = bits>>8 & 0xff;
o3 = bits & 0xff;
if (h3 == 64) enc += String.fromCharCode(o1);
else if (h4 == 64) enc += String.fromCharCode(o1, o2);
else enc += String.fromCharCode(o1, o2, o3);
} while (i < str.length);
return decodeUTF8(enc); // decode UTF-8 byte-array back to Unicode
}
function encodeUTF8(str) { // encode multi-byte string into utf-8 multiple single-byte characters
str = str.replace(
/[\u0080-\u07ff]/g, // U+0080 - U+07FF = 2-byte chars
function(c) {
var cc = c.charCodeAt(0);
return String.fromCharCode(0xc0 | cc>>6, 0x80 | cc&0x3f); }
);
str = str.replace(
/[\u0800-\uffff]/g, // U+0800 - U+FFFF = 3-byte chars
function(c) {
var cc = c.charCodeAt(0);
return String.fromCharCode(0xe0 | cc>>12, 0x80 | cc>>6&0x3F, 0x80 | cc&0x3f); }
);
return str;
}
function decodeUTF8(str) { // decode utf-8 encoded string back into multi-byte characters
str = str.replace(
/[\u00c0-\u00df][\u0080-\u00bf]/g, // 2-byte chars
function(c) {
var cc = (c.charCodeAt(0)&0x1f)<<6 | c.charCodeAt(1)&0x3f;
return String.fromCharCode(cc); }
);
str = str.replace(
/[\u00e0-\u00ef][\u0080-\u00bf][\u0080-\u00bf]/g, // 3-byte chars
function(c) {
var cc = (c.charCodeAt(0)&0x0f)<<12 | (c.charCodeAt(1)&0x3f<<6) | c.charCodeAt(2)&0x3f;
return String.fromCharCode(cc); }
);
return str;
}
function byteArrayToHexStr(b) { // convert byte array to hex string for displaying test vectors
var s = '';
for (var i=0; i<b.length; i++) s += b[i].toString(16) + ' ';
return s;
}
/* - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - */
var plainText = "ROMEO: But, soft! what light through yonder window breaks?\n\
It is the east, and Juliet is the sun.\n\
Arise, fair sun, and kill the envious moon,\n\
Who is already sick and pale with grief,\n\
That thou her maid art far more fair than she:\n\
Be not her maid, since she is envious;\n\
Her vestal livery is but sick and green\n\
And none but fools do wear it; cast it off.\n\
It is my lady, O, it is my love!\n\
O, that she knew she were!\n\
She speaks yet she says nothing: what of that?\n\
Her eye discourses; I will answer it.\n\
I am too bold, 'tis not to me she speaks:\n\
Two of the fairest stars in all the heaven,\n\
Having some business, do entreat her eyes\n\
To twinkle in their spheres till they return.\n\
What if her eyes were there, they in her head?\n\
The brightness of her cheek would shame those stars,\n\
As daylight doth a lamp; her eyes in heaven\n\
Would through the airy region stream so bright\n\
That birds would sing and think it were not night.\n\
See, how she leans her cheek upon her hand!\n\
O, that I were a glove upon that hand,\n\
That I might touch that cheek!\n\
JULIET: Ay me!\n\
ROMEO: She speaks:\n\
O, speak again, bright angel! for thou art\n\
As glorious to this night, being o'er my head\n\
As is a winged messenger of heaven\n\
Unto the white-upturned wondering eyes\n\
Of mortals that fall back to gaze on him\n\
When he bestrides the lazy-pacing clouds\n\
And sails upon the bosom of the air.";
var password = "O Romeo, Romeo! wherefore art thou Romeo?";
var cipherText = AESEncryptCtr(plainText, password, 256);
var decryptedText = AESDecryptCtr(cipherText, password, 256);
assertEq(plainText, decryptedText);

287
js/src/trace-test/tests/sunspider/check-crypto-md5.js Normal file
Просмотреть файл

@ -0,0 +1,287 @@
/*
* A JavaScript implementation of the RSA Data Security, Inc. MD5 Message
* Digest Algorithm, as defined in RFC 1321.
* Version 2.1 Copyright (C) Paul Johnston 1999 - 2002.
* Other contributors: Greg Holt, Andrew Kepert, Ydnar, Lostinet
* Distributed under the BSD License
* See http://pajhome.org.uk/crypt/md5 for more info.
*/
/*
* Configurable variables. You may need to tweak these to be compatible with
* the server-side, but the defaults work in most cases.
*/
var hexcase = 0; /* hex output format. 0 - lowercase; 1 - uppercase */
var b64pad = ""; /* base-64 pad character. "=" for strict RFC compliance */
var chrsz = 8; /* bits per input character. 8 - ASCII; 16 - Unicode */
/*
* These are the functions you'll usually want to call
* They take string arguments and return either hex or base-64 encoded strings
*/
function hex_md5(s){ return binl2hex(core_md5(str2binl(s), s.length * chrsz));}
function b64_md5(s){ return binl2b64(core_md5(str2binl(s), s.length * chrsz));}
function str_md5(s){ return binl2str(core_md5(str2binl(s), s.length * chrsz));}
function hex_hmac_md5(key, data) { return binl2hex(core_hmac_md5(key, data)); }
function b64_hmac_md5(key, data) { return binl2b64(core_hmac_md5(key, data)); }
function str_hmac_md5(key, data) { return binl2str(core_hmac_md5(key, data)); }
/*
* Perform a simple self-test to see if the VM is working
*/
function md5_vm_test()
{
return hex_md5("abc") == "900150983cd24fb0d6963f7d28e17f72";
}
/*
* Calculate the MD5 of an array of little-endian words, and a bit length
*/
function core_md5(x, len)
{
/* append padding */
x[len >> 5] |= 0x80 << ((len) % 32);
x[(((len + 64) >>> 9) << 4) + 14] = len;
var a = 1732584193;
var b = -271733879;
var c = -1732584194;
var d = 271733878;
for(var i = 0; i < x.length; i += 16)
{
var olda = a;
var oldb = b;
var oldc = c;
var oldd = d;
a = md5_ff(a, b, c, d, x[i+ 0], 7 , -680876936);
d = md5_ff(d, a, b, c, x[i+ 1], 12, -389564586);
c = md5_ff(c, d, a, b, x[i+ 2], 17, 606105819);
b = md5_ff(b, c, d, a, x[i+ 3], 22, -1044525330);
a = md5_ff(a, b, c, d, x[i+ 4], 7 , -176418897);
d = md5_ff(d, a, b, c, x[i+ 5], 12, 1200080426);
c = md5_ff(c, d, a, b, x[i+ 6], 17, -1473231341);
b = md5_ff(b, c, d, a, x[i+ 7], 22, -45705983);
a = md5_ff(a, b, c, d, x[i+ 8], 7 , 1770035416);
d = md5_ff(d, a, b, c, x[i+ 9], 12, -1958414417);
c = md5_ff(c, d, a, b, x[i+10], 17, -42063);
b = md5_ff(b, c, d, a, x[i+11], 22, -1990404162);
a = md5_ff(a, b, c, d, x[i+12], 7 , 1804603682);
d = md5_ff(d, a, b, c, x[i+13], 12, -40341101);
c = md5_ff(c, d, a, b, x[i+14], 17, -1502002290);
b = md5_ff(b, c, d, a, x[i+15], 22, 1236535329);
a = md5_gg(a, b, c, d, x[i+ 1], 5 , -165796510);
d = md5_gg(d, a, b, c, x[i+ 6], 9 , -1069501632);
c = md5_gg(c, d, a, b, x[i+11], 14, 643717713);
b = md5_gg(b, c, d, a, x[i+ 0], 20, -373897302);
a = md5_gg(a, b, c, d, x[i+ 5], 5 , -701558691);
d = md5_gg(d, a, b, c, x[i+10], 9 , 38016083);
c = md5_gg(c, d, a, b, x[i+15], 14, -660478335);
b = md5_gg(b, c, d, a, x[i+ 4], 20, -405537848);
a = md5_gg(a, b, c, d, x[i+ 9], 5 , 568446438);
d = md5_gg(d, a, b, c, x[i+14], 9 , -1019803690);
c = md5_gg(c, d, a, b, x[i+ 3], 14, -187363961);
b = md5_gg(b, c, d, a, x[i+ 8], 20, 1163531501);
a = md5_gg(a, b, c, d, x[i+13], 5 , -1444681467);
d = md5_gg(d, a, b, c, x[i+ 2], 9 , -51403784);
c = md5_gg(c, d, a, b, x[i+ 7], 14, 1735328473);
b = md5_gg(b, c, d, a, x[i+12], 20, -1926607734);
a = md5_hh(a, b, c, d, x[i+ 5], 4 , -378558);
d = md5_hh(d, a, b, c, x[i+ 8], 11, -2022574463);
c = md5_hh(c, d, a, b, x[i+11], 16, 1839030562);
b = md5_hh(b, c, d, a, x[i+14], 23, -35309556);
a = md5_hh(a, b, c, d, x[i+ 1], 4 , -1530992060);
d = md5_hh(d, a, b, c, x[i+ 4], 11, 1272893353);
c = md5_hh(c, d, a, b, x[i+ 7], 16, -155497632);
b = md5_hh(b, c, d, a, x[i+10], 23, -1094730640);
a = md5_hh(a, b, c, d, x[i+13], 4 , 681279174);
d = md5_hh(d, a, b, c, x[i+ 0], 11, -358537222);
c = md5_hh(c, d, a, b, x[i+ 3], 16, -722521979);
b = md5_hh(b, c, d, a, x[i+ 6], 23, 76029189);
a = md5_hh(a, b, c, d, x[i+ 9], 4 , -640364487);
d = md5_hh(d, a, b, c, x[i+12], 11, -421815835);
c = md5_hh(c, d, a, b, x[i+15], 16, 530742520);
b = md5_hh(b, c, d, a, x[i+ 2], 23, -995338651);
a = md5_ii(a, b, c, d, x[i+ 0], 6 , -198630844);
d = md5_ii(d, a, b, c, x[i+ 7], 10, 1126891415);
c = md5_ii(c, d, a, b, x[i+14], 15, -1416354905);
b = md5_ii(b, c, d, a, x[i+ 5], 21, -57434055);
a = md5_ii(a, b, c, d, x[i+12], 6 , 1700485571);
d = md5_ii(d, a, b, c, x[i+ 3], 10, -1894986606);
c = md5_ii(c, d, a, b, x[i+10], 15, -1051523);
b = md5_ii(b, c, d, a, x[i+ 1], 21, -2054922799);
a = md5_ii(a, b, c, d, x[i+ 8], 6 , 1873313359);
d = md5_ii(d, a, b, c, x[i+15], 10, -30611744);
c = md5_ii(c, d, a, b, x[i+ 6], 15, -1560198380);
b = md5_ii(b, c, d, a, x[i+13], 21, 1309151649);
a = md5_ii(a, b, c, d, x[i+ 4], 6 , -145523070);
d = md5_ii(d, a, b, c, x[i+11], 10, -1120210379);
c = md5_ii(c, d, a, b, x[i+ 2], 15, 718787259);
b = md5_ii(b, c, d, a, x[i+ 9], 21, -343485551);
a = safe_add(a, olda);
b = safe_add(b, oldb);
c = safe_add(c, oldc);
d = safe_add(d, oldd);
}
return Array(a, b, c, d);
}
/*
* These functions implement the four basic operations the algorithm uses.
*/
function md5_cmn(q, a, b, x, s, t)
{
return safe_add(bit_rol(safe_add(safe_add(a, q), safe_add(x, t)), s),b);
}
function md5_ff(a, b, c, d, x, s, t)
{
return md5_cmn((b & c) | ((~b) & d), a, b, x, s, t);
}
function md5_gg(a, b, c, d, x, s, t)
{
return md5_cmn((b & d) | (c & (~d)), a, b, x, s, t);
}
function md5_hh(a, b, c, d, x, s, t)
{
return md5_cmn(b ^ c ^ d, a, b, x, s, t);
}
function md5_ii(a, b, c, d, x, s, t)
{
return md5_cmn(c ^ (b | (~d)), a, b, x, s, t);
}
/*
* Calculate the HMAC-MD5, of a key and some data
*/
function core_hmac_md5(key, data)
{
var bkey = str2binl(key);
if(bkey.length > 16) bkey = core_md5(bkey, key.length * chrsz);
var ipad = Array(16), opad = Array(16);
for(var i = 0; i < 16; i++)
{
ipad[i] = bkey[i] ^ 0x36363636;
opad[i] = bkey[i] ^ 0x5C5C5C5C;
}
var hash = core_md5(ipad.concat(str2binl(data)), 512 + data.length * chrsz);
return core_md5(opad.concat(hash), 512 + 128);
}
/*
* Add integers, wrapping at 2^32. This uses 16-bit operations internally
* to work around bugs in some JS interpreters.
*/
function safe_add(x, y)
{
var lsw = (x & 0xFFFF) + (y & 0xFFFF);
var msw = (x >> 16) + (y >> 16) + (lsw >> 16);
return (msw << 16) | (lsw & 0xFFFF);
}
/*
* Bitwise rotate a 32-bit number to the left.
*/
function bit_rol(num, cnt)
{
return (num << cnt) | (num >>> (32 - cnt));
}
/*
* Convert a string to an array of little-endian words
* If chrsz is ASCII, characters >255 have their hi-byte silently ignored.
*/
function str2binl(str)
{
var bin = Array();
var mask = (1 << chrsz) - 1;
for(var i = 0; i < str.length * chrsz; i += chrsz)
bin[i>>5] |= (str.charCodeAt(i / chrsz) & mask) << (i%32);
return bin;
}
/*
* Convert an array of little-endian words to a string
*/
function binl2str(bin)
{
var str = "";
var mask = (1 << chrsz) - 1;
for(var i = 0; i < bin.length * 32; i += chrsz)
str += String.fromCharCode((bin[i>>5] >>> (i % 32)) & mask);
return str;
}
/*
* Convert an array of little-endian words to a hex string.
*/
function binl2hex(binarray)
{
var hex_tab = hexcase ? "0123456789ABCDEF" : "0123456789abcdef";
var str = "";
for(var i = 0; i < binarray.length * 4; i++)
{
str += hex_tab.charAt((binarray[i>>2] >> ((i%4)*8+4)) & 0xF) +
hex_tab.charAt((binarray[i>>2] >> ((i%4)*8 )) & 0xF);
}
return str;
}
/*
* Convert an array of little-endian words to a base-64 string
*/
function binl2b64(binarray)
{
var tab = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/";
var str = "";
for(var i = 0; i < binarray.length * 4; i += 3)
{
var triplet = (((binarray[i >> 2] >> 8 * ( i %4)) & 0xFF) << 16)
| (((binarray[i+1 >> 2] >> 8 * ((i+1)%4)) & 0xFF) << 8 )
| ((binarray[i+2 >> 2] >> 8 * ((i+2)%4)) & 0xFF);
for(var j = 0; j < 4; j++)
{
if(i * 8 + j * 6 > binarray.length * 32) str += b64pad;
else str += tab.charAt((triplet >> 6*(3-j)) & 0x3F);
}
}
return str;
}
var plainText = "Rebellious subjects, enemies to peace,\n\
Profaners of this neighbour-stained steel,--\n\
Will they not hear? What, ho! you men, you beasts,\n\
That quench the fire of your pernicious rage\n\
With purple fountains issuing from your veins,\n\
On pain of torture, from those bloody hands\n\
Throw your mistemper'd weapons to the ground,\n\
And hear the sentence of your moved prince.\n\
Three civil brawls, bred of an airy word,\n\
By thee, old Capulet, and Montague,\n\
Have thrice disturb'd the quiet of our streets,\n\
And made Verona's ancient citizens\n\
Cast by their grave beseeming ornaments,\n\
To wield old partisans, in hands as old,\n\
Canker'd with peace, to part your canker'd hate:\n\
If ever you disturb our streets again,\n\
Your lives shall pay the forfeit of the peace.\n\
For this time, all the rest depart away:\n\
You Capulet; shall go along with me:\n\
And, Montague, come you this afternoon,\n\
To know our further pleasure in this case,\n\
To old Free-town, our common judgment-place.\n\
Once more, on pain of death, all men depart."
for (var i = 0; i <4; i++) {
plainText += plainText;
}
var md5Output = hex_md5(plainText);
assertEq(md5Output, "a831e91e0f70eddcb70dc61c6f82f6cd")

225
js/src/trace-test/tests/sunspider/check-crypto-sha1.js Normal file
Просмотреть файл

@ -0,0 +1,225 @@
/*
* A JavaScript implementation of the Secure Hash Algorithm, SHA-1, as defined
* in FIPS PUB 180-1
* Version 2.1a Copyright Paul Johnston 2000 - 2002.
* Other contributors: Greg Holt, Andrew Kepert, Ydnar, Lostinet
* Distributed under the BSD License
* See http://pajhome.org.uk/crypt/md5 for details.
*/
/*
* Configurable variables. You may need to tweak these to be compatible with
* the server-side, but the defaults work in most cases.
*/
var hexcase = 0; /* hex output format. 0 - lowercase; 1 - uppercase */
var b64pad = ""; /* base-64 pad character. "=" for strict RFC compliance */
var chrsz = 8; /* bits per input character. 8 - ASCII; 16 - Unicode */
/*
* These are the functions you'll usually want to call
* They take string arguments and return either hex or base-64 encoded strings
*/
function hex_sha1(s){return binb2hex(core_sha1(str2binb(s),s.length * chrsz));}
function b64_sha1(s){return binb2b64(core_sha1(str2binb(s),s.length * chrsz));}
function str_sha1(s){return binb2str(core_sha1(str2binb(s),s.length * chrsz));}
function hex_hmac_sha1(key, data){ return binb2hex(core_hmac_sha1(key, data));}
function b64_hmac_sha1(key, data){ return binb2b64(core_hmac_sha1(key, data));}
function str_hmac_sha1(key, data){ return binb2str(core_hmac_sha1(key, data));}
/*
* Perform a simple self-test to see if the VM is working
*/
function sha1_vm_test()
{
return hex_sha1("abc") == "a9993e364706816aba3e25717850c26c9cd0d89d";
}
/*
* Calculate the SHA-1 of an array of big-endian words, and a bit length
*/
function core_sha1(x, len)
{
/* append padding */
x[len >> 5] |= 0x80 << (24 - len % 32);
x[((len + 64 >> 9) << 4) + 15] = len;
var w = Array(80);
var a = 1732584193;
var b = -271733879;
var c = -1732584194;
var d = 271733878;
var e = -1009589776;
for(var i = 0; i < x.length; i += 16)
{
var olda = a;
var oldb = b;
var oldc = c;
var oldd = d;
var olde = e;
for(var j = 0; j < 80; j++)
{
if(j < 16) w[j] = x[i + j];
else w[j] = rol(w[j-3] ^ w[j-8] ^ w[j-14] ^ w[j-16], 1);
var t = safe_add(safe_add(rol(a, 5), sha1_ft(j, b, c, d)),
safe_add(safe_add(e, w[j]), sha1_kt(j)));
e = d;
d = c;
c = rol(b, 30);
b = a;
a = t;
}
a = safe_add(a, olda);
b = safe_add(b, oldb);
c = safe_add(c, oldc);
d = safe_add(d, oldd);
e = safe_add(e, olde);
}
return Array(a, b, c, d, e);
}
/*
* Perform the appropriate triplet combination function for the current
* iteration
*/
function sha1_ft(t, b, c, d)
{
if(t < 20) return (b & c) | ((~b) & d);
if(t < 40) return b ^ c ^ d;
if(t < 60) return (b & c) | (b & d) | (c & d);
return b ^ c ^ d;
}
/*
* Determine the appropriate additive constant for the current iteration
*/
function sha1_kt(t)
{
return (t < 20) ? 1518500249 : (t < 40) ? 1859775393 :
(t < 60) ? -1894007588 : -899497514;
}
/*
* Calculate the HMAC-SHA1 of a key and some data
*/
function core_hmac_sha1(key, data)
{
var bkey = str2binb(key);
if(bkey.length > 16) bkey = core_sha1(bkey, key.length * chrsz);
var ipad = Array(16), opad = Array(16);
for(var i = 0; i < 16; i++)
{
ipad[i] = bkey[i] ^ 0x36363636;
opad[i] = bkey[i] ^ 0x5C5C5C5C;
}
var hash = core_sha1(ipad.concat(str2binb(data)), 512 + data.length * chrsz);
return core_sha1(opad.concat(hash), 512 + 160);
}
/*
* Add integers, wrapping at 2^32. This uses 16-bit operations internally
* to work around bugs in some JS interpreters.
*/
function safe_add(x, y)
{
var lsw = (x & 0xFFFF) + (y & 0xFFFF);
var msw = (x >> 16) + (y >> 16) + (lsw >> 16);
return (msw << 16) | (lsw & 0xFFFF);
}
/*
* Bitwise rotate a 32-bit number to the left.
*/
function rol(num, cnt)
{
return (num << cnt) | (num >>> (32 - cnt));
}
/*
* Convert an 8-bit or 16-bit string to an array of big-endian words
* In 8-bit function, characters >255 have their hi-byte silently ignored.
*/
function str2binb(str)
{
var bin = Array();
var mask = (1 << chrsz) - 1;
for(var i = 0; i < str.length * chrsz; i += chrsz)
bin[i>>5] |= (str.charCodeAt(i / chrsz) & mask) << (32 - chrsz - i%32);
return bin;
}
/*
* Convert an array of big-endian words to a string
*/
function binb2str(bin)
{
var str = "";
var mask = (1 << chrsz) - 1;
for(var i = 0; i < bin.length * 32; i += chrsz)
str += String.fromCharCode((bin[i>>5] >>> (32 - chrsz - i%32)) & mask);
return str;
}
/*
* Convert an array of big-endian words to a hex string.
*/
function binb2hex(binarray)
{
var hex_tab = hexcase ? "0123456789ABCDEF" : "0123456789abcdef";
var str = "";
for(var i = 0; i < binarray.length * 4; i++)
{
str += hex_tab.charAt((binarray[i>>2] >> ((3 - i%4)*8+4)) & 0xF) +
hex_tab.charAt((binarray[i>>2] >> ((3 - i%4)*8 )) & 0xF);
}
return str;
}
/*
* Convert an array of big-endian words to a base-64 string
*/
function binb2b64(binarray)
{
var tab = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789+/";
var str = "";
for(var i = 0; i < binarray.length * 4; i += 3)
{
var triplet = (((binarray[i >> 2] >> 8 * (3 - i %4)) & 0xFF) << 16)
| (((binarray[i+1 >> 2] >> 8 * (3 - (i+1)%4)) & 0xFF) << 8 )
| ((binarray[i+2 >> 2] >> 8 * (3 - (i+2)%4)) & 0xFF);
for(var j = 0; j < 4; j++)
{
if(i * 8 + j * 6 > binarray.length * 32) str += b64pad;
else str += tab.charAt((triplet >> 6*(3-j)) & 0x3F);
}
}
return str;
}
var plainText = "Two households, both alike in dignity,\n\
In fair Verona, where we lay our scene,\n\
From ancient grudge break to new mutiny,\n\
Where civil blood makes civil hands unclean.\n\
From forth the fatal loins of these two foes\n\
A pair of star-cross'd lovers take their life;\n\
Whole misadventured piteous overthrows\n\
Do with their death bury their parents' strife.\n\
The fearful passage of their death-mark'd love,\n\
And the continuance of their parents' rage,\n\
Which, but their children's end, nought could remove,\n\
Is now the two hours' traffic of our stage;\n\
The which if you with patient ears attend,\n\
What here shall miss, our toil shall strive to mend.";
for (var i = 0; i <4; i++) {
plainText += plainText;
}
var sha1Output = hex_sha1(plainText);
assertEq(sha1Output, "2524d264def74cce2498bf112bedf00e6c0b796d")

100
js/src/trace-test/tests/sunspider/check-math-cordic.js Normal file
Просмотреть файл

@ -0,0 +1,100 @@
/*
* Copyright (C) Rich Moore. All rights reserved.
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions
* are met:
* 1. Redistributions of source code must retain the above copyright
* notice, this list of conditions and the following disclaimer.
* 2. Redistributions in binary form must reproduce the above copyright
* notice, this list of conditions and the following disclaimer in the
* documentation and/or other materials provided with the distribution.
*
* THIS SOFTWARE IS PROVIDED BY CONTRIBUTORS ``AS IS'' AND ANY
* EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
* IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
* PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR
* CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
* EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
* PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
* PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
* OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
* (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
* OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
*/
/////. Start CORDIC
var AG_CONST = 0.6072529350;
function FIXED(X)
{
return X * 65536.0;
}
function FLOAT(X)
{
return X / 65536.0;
}
function DEG2RAD(X)
{
return 0.017453 * (X);
}
var Angles = [
FIXED(45.0), FIXED(26.565), FIXED(14.0362), FIXED(7.12502),
FIXED(3.57633), FIXED(1.78991), FIXED(0.895174), FIXED(0.447614),
FIXED(0.223811), FIXED(0.111906), FIXED(0.055953),
FIXED(0.027977)
];
function cordicsincos() {
var X;
var Y;
var TargetAngle;
var CurrAngle;
var Step;
X = FIXED(AG_CONST); /* AG_CONST * cos(0) */
Y = 0; /* AG_CONST * sin(0) */
TargetAngle = FIXED(28.027);
CurrAngle = 0;
for (Step = 0; Step < 12; Step++) {
var NewX;
if (TargetAngle > CurrAngle) {
NewX = X - (Y >> Step);
Y = (X >> Step) + Y;
X = NewX;
CurrAngle += Angles[Step];
} else {
NewX = X + (Y >> Step);
Y = -(X >> Step) + Y;
X = NewX;
CurrAngle -= Angles[Step];
}
}
return CurrAngle;
}
///// End CORDIC
function cordic( runs ) {
var actual;
var start = new Date();
for ( var i = 0 ; i < runs ; i++ ) {
actual = cordicsincos();
}
var end = new Date();
assertEq(actual, 1834995.3515519998)
return end.getTime() - start.getTime();
}
cordic(25000);

36
js/src/trace-test/tests/sunspider/check-math-partial-sums.js Normal file
Просмотреть файл

@ -0,0 +1,36 @@
// The Computer Language Shootout
// http://shootout.alioth.debian.org/
// contributed by Isaac Gouy
function partial(n){
var a1 = a2 = a3 = a4 = a5 = a6 = a7 = a8 = a9 = 0.0;
var twothirds = 2.0/3.0;
var alt = -1.0;
var k2 = k3 = sk = ck = 0.0;
for (var k = 1; k <= n; k++){
k2 = k*k;
k3 = k2*k;
sk = Math.sin(k);
ck = Math.cos(k);
alt = -alt;
a1 += Math.pow(twothirds,k-1);
a2 += Math.pow(k,-0.5);
a3 += 1.0/(k*(k+1.0));
a4 += 1.0/(k3 * sk*sk);
a5 += 1.0/(k3 * ck*ck);
a6 += 1.0/k;
a7 += 1.0/k2;
a8 += alt/k;
a9 += alt/(2*k -1);
}
return [ a1, a2, a3, a4, a5, a6, a7, a8, a9 ].join(',');
}
var actual = '';
for (var i = 1024; i <= 16384; i *= 2) {
actual += partial(i) + ';';
}
assertEq(actual, "2.9999999999999987,62.555269219624684,0.9990243902439033,30.174793391263677,42.99468748637077,7.509175672278132,1.6439579810301654,0.6926591377284127,0.785154022830656;2.9999999999999987,89.06036157695789,0.9995119570522216,30.30796333494624,42.99485339033617,8.202078771817716,1.6444459047881168,0.6929030995395857,0.7852760930922243;2.9999999999999987,126.54745783224483,0.999755918965097,30.314167756318135,42.994888939123,8.89510389696629,1.6446899560231332,0.6930251251486118,0.7853371282421086;2.9999999999999987,179.56450569047874,0.9998779445868421,30.314499725429847,42.99489723774016,9.588190046095265,1.644812003986005,0.693086149128997,0.785367645819433;2.9999999999999987,254.54355172132264,0.9999389685688135,30.31451920492601,42.99489939769195,10.281306710008463,1.6448730335545856,0.6931166639131536,0.7853829046083998;")

53
js/src/trace-test/tests/sunspider/check-math-spectral-norm.js Normal file
Просмотреть файл

@ -0,0 +1,53 @@
// The Great Computer Language Shootout
// http://shootout.alioth.debian.org/
//
// contributed by Ian Osgood
function A(i,j) {
return 1/((i+j)*(i+j+1)/2+i+1);
}
function Au(u,v) {
for (var i=0; i<u.length; ++i) {
var t = 0;
for (var j=0; j<u.length; ++j)
t += A(i,j) * u[j];
v[i] = t;
}
}
function Atu(u,v) {
for (var i=0; i<u.length; ++i) {
var t = 0;
for (var j=0; j<u.length; ++j)
t += A(j,i) * u[j];
v[i] = t;
}
}
function AtAu(u,v,w) {
Au(u,w);
Atu(w,v);
}
function spectralnorm(n) {
var i, u=[], v=[], w=[], vv=0, vBv=0;
for (i=0; i<n; ++i) {
u[i] = 1; v[i] = w[i] = 0;
}
for (i=0; i<10; ++i) {
AtAu(u,v,w);
AtAu(v,u,w);
}
for (i=0; i<n; ++i) {
vBv += u[i]*v[i];
vv += v[i]*v[i];
}
return Math.sqrt(vBv/vv);
}
var actual = '';
for (var i = 6; i <= 48; i *= 2) {
actual += spectralnorm(i) + ',';
}
assertEq(actual, "1.2657786149754053,1.2727355112619148,1.273989979775574,1.274190125290389,");

1714
js/src/trace-test/tests/sunspider/check-regexp-dna.js Normal file
Просмотреть файл

Разница между файлами не показана из-за своего большого размера Загрузить разницу

90
js/src/trace-test/tests/sunspider/check-string-fasta.js Normal file
Просмотреть файл

@ -0,0 +1,90 @@
// The Great Computer Language Shootout
// http://shootout.alioth.debian.org
//
// Contributed by Ian Osgood
var last = 42, A = 3877, C = 29573, M = 139968;
function rand(max) {
last = (last * A + C) % M;
return max * last / M;
}
var ALU =
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
var IUB = {
a:0.27, c:0.12, g:0.12, t:0.27,
B:0.02, D:0.02, H:0.02, K:0.02,
M:0.02, N:0.02, R:0.02, S:0.02,
V:0.02, W:0.02, Y:0.02
}
var HomoSap = {
a: 0.3029549426680,
c: 0.1979883004921,
g: 0.1975473066391,
t: 0.3015094502008
}
function makeCumulative(table) {
var last = null;
for (var c in table) {
if (last) table[c] += table[last];
last = c;
}
}
function fastaRepeat(n, seq) {
var seqi = 0, lenOut = 60;
while (n>0) {
if (n<lenOut) lenOut = n;
if (seqi + lenOut < seq.length) {
ret = seq.substring(seqi, seqi+lenOut);
seqi += lenOut;
} else {
var s = seq.substring(seqi);
seqi = lenOut - s.length;
ret = s + seq.substring(0, seqi);
}
n -= lenOut;
}
return ret;
}
function fastaRandom(n, table) {
var line = new Array(60);
makeCumulative(table);
while (n>0) {
if (n<line.length) line = new Array(n);
for (var i=0; i<line.length; i++) {
var r = rand(1);
for (var c in table) {
if (r < table[c]) {
line[i] = c;
break;
}
}
}
ret = line.join('');
n -= line.length;
}
return ret;
}
var ret;
var count = 7;
var actual1 = fastaRepeat(2*count*100000, ALU);
var actual2 = fastaRandom(3*count*1000, IUB);
var actual3 = fastaRandom(5*count*1000, HomoSap);
assertEq(actual1, "CAAAAAGGCCGGGCGCGGTG");
assertEq(actual2, "VtttaDtKgcaaWaaaaatSccMcVatgtKgtaKgcgatatgtagtSaaaDttatacaaa");
assertEq(actual3, "ttggctatatttatgttgga");

266
js/src/trace-test/tests/sunspider/check-string-tagcloud.js Normal file
Просмотреть файл

Различия файлов скрыты, потому что одна или несколько строк слишком длинны

73
js/src/trace-test/tests/sunspider/check-string-unpack-code.js Normal file
Просмотреть файл

Различия файлов скрыты, потому что одна или несколько строк слишком длинны